Incidental Mutation 'R8678:Gli1'
ID 661527
Institutional Source Beutler Lab
Gene Symbol Gli1
Ensembl Gene ENSMUSG00000025407
Gene Name GLI-Kruppel family member GLI1
Synonyms Zfp-5, Zfp5
MMRRC Submission 068533-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8678 (G1)
Quality Score 213.009
Status Validated
Chromosome 10
Chromosomal Location 127165751-127177448 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 127173260 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 133 (S133G)
Ref Sequence ENSEMBL: ENSMUSP00000026474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026474] [ENSMUST00000218236] [ENSMUST00000219671]
AlphaFold P47806
Predicted Effect probably null
Transcript: ENSMUST00000026474
AA Change: S133G

PolyPhen 2 Score 0.647 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000026474
Gene: ENSMUSG00000025407
AA Change: S133G

DomainStartEndE-ValueType
low complexity region 222 237 N/A INTRINSIC
ZnF_C2H2 238 263 1.33e-1 SMART
ZnF_C2H2 271 298 5.72e-1 SMART
ZnF_C2H2 304 328 2.57e-3 SMART
ZnF_C2H2 334 359 1.92e-2 SMART
ZnF_C2H2 365 390 2.61e-4 SMART
low complexity region 419 431 N/A INTRINSIC
low complexity region 540 562 N/A INTRINSIC
low complexity region 639 655 N/A INTRINSIC
low complexity region 748 759 N/A INTRINSIC
low complexity region 850 873 N/A INTRINSIC
low complexity region 941 962 N/A INTRINSIC
low complexity region 985 1002 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218236
Predicted Effect probably benign
Transcript: ENSMUST00000219671
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.7%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Kruppel family of zinc finger proteins. The encoded transcription factor is activated by the sonic hedgehog signal transduction cascade and regulates stem cell proliferation. The activity and nuclear localization of this protein is negatively regulated by p53 in an inhibitory loop. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygotes for a targeted null mutation are apparently normal, but homozygotes that are also heterozygous for a Gli2 knockout die soon after birth with multiple defects, while Gli2 knockout heterozygotes are normally viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 C T 16: 20,184,685 (GRCm39) M991I probably benign Het
Acacb T A 5: 114,340,032 (GRCm39) Y814* probably null Het
Alg2 A G 4: 47,474,108 (GRCm39) F60S probably damaging Het
Aoc1l1 C T 6: 48,953,158 (GRCm39) T361I possibly damaging Het
Arc A G 15: 74,543,539 (GRCm39) L228P probably damaging Het
Bnip1 T A 17: 27,008,923 (GRCm39) probably benign Het
Cacng4 A G 11: 107,625,925 (GRCm39) L222P probably damaging Het
Calb2 A T 8: 110,874,275 (GRCm39) V182E possibly damaging Het
Cfap44 A T 16: 44,295,636 (GRCm39) I1645F probably damaging Het
Col6a5 T C 9: 105,811,551 (GRCm39) D656G unknown Het
Csmd3 A G 15: 47,499,849 (GRCm39) S2096P Het
Cyp2c70 A T 19: 40,156,016 (GRCm39) I178N probably damaging Het
Dmxl1 C T 18: 50,004,759 (GRCm39) Q936* probably null Het
Dnaaf3 A T 7: 4,533,814 (GRCm39) F94Y probably damaging Het
Eid2b C T 7: 27,977,480 (GRCm39) T92I possibly damaging Het
Ercc8 T C 13: 108,306,027 (GRCm39) probably null Het
Fank1 G A 7: 133,463,957 (GRCm39) probably null Het
Fbxw19 C A 9: 109,312,376 (GRCm39) E324* probably null Het
Fcnb A G 2: 27,968,361 (GRCm39) F199L possibly damaging Het
Galnt16 A G 12: 80,630,822 (GRCm39) D300G probably damaging Het
Ighv5-8 TATACAT TAT 12: 113,618,583 (GRCm39) probably benign Het
Irak4 A G 15: 94,464,666 (GRCm39) D412G probably benign Het
Klhl20 A T 1: 160,936,997 (GRCm39) I126N probably damaging Het
Lama1 A G 17: 68,124,098 (GRCm39) E2841G Het
Lmtk3 T A 7: 45,435,975 (GRCm39) C85* probably null Het
Madd T C 2: 91,006,610 (GRCm39) Y328C probably damaging Het
Map1a G T 2: 121,137,737 (GRCm39) R2851L probably damaging Het
Mctp2 T C 7: 71,752,955 (GRCm39) D766G probably damaging Het
Mei4 T A 9: 81,809,638 (GRCm39) F240L probably damaging Het
Mgat3 A T 15: 80,096,472 (GRCm39) Y433F possibly damaging Het
Muc20 T A 16: 32,617,789 (GRCm39) probably benign Het
Nat8f1 A G 6: 85,887,738 (GRCm39) V74A probably benign Het
Nfe2l3 A G 6: 51,435,153 (GRCm39) D571G possibly damaging Het
Nlgn3 T C X: 100,352,390 (GRCm39) V179A probably damaging Het
Nphs1 T C 7: 30,163,284 (GRCm39) L480S probably damaging Het
Nr1d1 G C 11: 98,660,073 (GRCm39) R484G probably damaging Het
Or2ag2 A G 7: 106,485,280 (GRCm39) V248A probably damaging Het
Or4c122 T A 2: 89,079,351 (GRCm39) Y217F probably damaging Het
Or8j3b C T 2: 86,205,069 (GRCm39) R229H probably benign Het
Parp10 C A 15: 76,117,599 (GRCm39) C929F probably damaging Het
Pcdhb21 A G 18: 37,647,939 (GRCm39) E356G probably damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 (GRCm39) probably benign Het
Plch1 T A 3: 63,623,468 (GRCm39) R600* probably null Het
Ppp1r13l C A 7: 19,109,697 (GRCm39) T706K probably benign Het
Ppp1r16b G A 2: 158,593,098 (GRCm39) D226N probably damaging Het
Ppp1r16b G A 2: 158,598,942 (GRCm39) R334Q probably damaging Het
Ppp1r7 A G 1: 93,280,364 (GRCm39) Q188R probably benign Het
Pramel26 C A 4: 143,538,576 (GRCm39) A132S probably benign Het
Prkdc G T 16: 15,526,796 (GRCm39) probably null Het
Prss33 T C 17: 24,053,723 (GRCm39) D118G probably benign Het
Rab3gap2 T G 1: 184,983,281 (GRCm39) I473M probably damaging Het
Rbm44 A G 1: 91,080,103 (GRCm39) E97G probably damaging Het
Ros1 A G 10: 51,963,998 (GRCm39) M1775T probably benign Het
Ryr1 T A 7: 28,776,489 (GRCm39) M2216L probably damaging Het
Scn7a A G 2: 66,574,041 (GRCm39) probably benign Het
Slc31a2 G A 4: 62,210,896 (GRCm39) V12M probably benign Het
Slc35b1 T C 11: 95,278,646 (GRCm39) Y177H probably damaging Het
Slfn9 T A 11: 82,872,370 (GRCm39) M789L probably benign Het
Srf A G 17: 46,861,825 (GRCm39) probably null Het
Tank A G 2: 61,457,287 (GRCm39) E81G probably damaging Het
Tia1 T A 6: 86,402,685 (GRCm39) M241K probably benign Het
Tiam1 G T 16: 89,681,709 (GRCm39) S423* probably null Het
Tubg1 T G 11: 101,015,264 (GRCm39) S237A probably benign Het
Ubash3b G A 9: 40,942,785 (GRCm39) P358S probably benign Het
Vmn2r3 T C 3: 64,166,896 (GRCm39) E745G possibly damaging Het
Vmn2r4 T A 3: 64,314,391 (GRCm39) I197F probably benign Het
Vps37d C A 5: 135,105,386 (GRCm39) R79L probably damaging Het
Wdr7 T A 18: 63,910,768 (GRCm39) L720Q probably damaging Het
Xkr5 T C 8: 18,984,048 (GRCm39) N498S probably benign Het
Zc2hc1c A T 12: 85,337,084 (GRCm39) E247V probably benign Het
Other mutations in Gli1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01543:Gli1 APN 10 127,168,347 (GRCm39) missense probably damaging 1.00
IGL01824:Gli1 APN 10 127,172,396 (GRCm39) missense probably benign 0.44
IGL02134:Gli1 APN 10 127,172,369 (GRCm39) missense probably benign 0.00
IGL02508:Gli1 APN 10 127,172,961 (GRCm39) missense probably benign 0.14
IGL02931:Gli1 APN 10 127,168,279 (GRCm39) missense probably benign 0.00
R0099:Gli1 UTSW 10 127,171,875 (GRCm39) missense probably damaging 1.00
R0590:Gli1 UTSW 10 127,167,432 (GRCm39) missense possibly damaging 0.82
R0792:Gli1 UTSW 10 127,168,446 (GRCm39) missense probably damaging 0.99
R1169:Gli1 UTSW 10 127,174,320 (GRCm39) missense probably damaging 1.00
R1519:Gli1 UTSW 10 127,170,138 (GRCm39) missense possibly damaging 0.93
R1522:Gli1 UTSW 10 127,168,446 (GRCm39) missense probably damaging 0.99
R1550:Gli1 UTSW 10 127,174,385 (GRCm39) missense probably damaging 1.00
R1592:Gli1 UTSW 10 127,167,198 (GRCm39) missense probably damaging 0.97
R1879:Gli1 UTSW 10 127,169,606 (GRCm39) missense probably damaging 1.00
R1892:Gli1 UTSW 10 127,165,975 (GRCm39) missense possibly damaging 0.82
R1934:Gli1 UTSW 10 127,167,108 (GRCm39) missense possibly damaging 0.65
R2049:Gli1 UTSW 10 127,172,596 (GRCm39) missense probably damaging 1.00
R2088:Gli1 UTSW 10 127,167,369 (GRCm39) missense probably damaging 1.00
R2141:Gli1 UTSW 10 127,172,596 (GRCm39) missense probably damaging 1.00
R3803:Gli1 UTSW 10 127,173,934 (GRCm39) splice site probably benign
R3873:Gli1 UTSW 10 127,167,225 (GRCm39) missense probably damaging 1.00
R3874:Gli1 UTSW 10 127,166,088 (GRCm39) missense probably damaging 1.00
R3899:Gli1 UTSW 10 127,172,535 (GRCm39) missense possibly damaging 0.64
R4703:Gli1 UTSW 10 127,166,724 (GRCm39) missense possibly damaging 0.88
R5552:Gli1 UTSW 10 127,166,131 (GRCm39) missense probably benign 0.00
R5686:Gli1 UTSW 10 127,173,305 (GRCm39) missense probably benign 0.01
R5812:Gli1 UTSW 10 127,173,284 (GRCm39) missense probably damaging 1.00
R6053:Gli1 UTSW 10 127,170,184 (GRCm39) missense probably damaging 1.00
R7088:Gli1 UTSW 10 127,171,868 (GRCm39) missense probably damaging 1.00
R7162:Gli1 UTSW 10 127,168,306 (GRCm39) missense probably benign
R8229:Gli1 UTSW 10 127,168,317 (GRCm39) missense possibly damaging 0.93
R8322:Gli1 UTSW 10 127,167,477 (GRCm39) missense probably damaging 1.00
R8447:Gli1 UTSW 10 127,166,106 (GRCm39) missense probably benign 0.00
R9123:Gli1 UTSW 10 127,167,202 (GRCm39) missense possibly damaging 0.81
R9377:Gli1 UTSW 10 127,173,359 (GRCm39) missense possibly damaging 0.56
Z1177:Gli1 UTSW 10 127,172,560 (GRCm39) missense probably benign 0.00
Z1177:Gli1 UTSW 10 127,171,867 (GRCm39) missense probably damaging 1.00
Z1177:Gli1 UTSW 10 127,170,126 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGCAGGTTTCTGGGAG -3'
(R):5'- AGTGCAGGGATACAATGTACCTT -3'

Sequencing Primer
(F):5'- GGTGTGGTTGAAGAAGCCC -3'
(R):5'- CTCAGATTCTTTGAAGGAACGGC -3'
Posted On 2021-03-08