Incidental Mutation 'R8678:Galnt16'
ID 661533
Institutional Source Beutler Lab
Gene Symbol Galnt16
Ensembl Gene ENSMUSG00000021130
Gene Name polypeptide N-acetylgalactosaminyltransferase 16
Synonyms Galntl1, 5730405L21Rik
MMRRC Submission 068533-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.112) question?
Stock # R8678 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 80565245-80650672 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 80630822 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 300 (D300G)
Ref Sequence ENSEMBL: ENSMUSP00000021558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021558] [ENSMUST00000218943] [ENSMUST00000219993]
AlphaFold Q9JJ61
Predicted Effect probably damaging
Transcript: ENSMUST00000021558
AA Change: D300G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021558
Gene: ENSMUSG00000021130
AA Change: D300G

DomainStartEndE-ValueType
transmembrane domain 7 25 N/A INTRINSIC
low complexity region 29 46 N/A INTRINSIC
Pfam:Glycos_transf_2 126 308 1.2e-24 PFAM
Pfam:Glyco_tranf_2_2 126 356 1.6e-9 PFAM
Pfam:Glyco_transf_7C 277 352 2.2e-10 PFAM
Blast:RICIN 362 395 1e-10 BLAST
RICIN 432 555 1.41e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000218943
AA Change: D300G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000219993
AA Change: D300G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.4166 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.7%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 C T 16: 20,184,685 (GRCm39) M991I probably benign Het
Acacb T A 5: 114,340,032 (GRCm39) Y814* probably null Het
Alg2 A G 4: 47,474,108 (GRCm39) F60S probably damaging Het
Aoc1l1 C T 6: 48,953,158 (GRCm39) T361I possibly damaging Het
Arc A G 15: 74,543,539 (GRCm39) L228P probably damaging Het
Bnip1 T A 17: 27,008,923 (GRCm39) probably benign Het
Cacng4 A G 11: 107,625,925 (GRCm39) L222P probably damaging Het
Calb2 A T 8: 110,874,275 (GRCm39) V182E possibly damaging Het
Cfap44 A T 16: 44,295,636 (GRCm39) I1645F probably damaging Het
Col6a5 T C 9: 105,811,551 (GRCm39) D656G unknown Het
Csmd3 A G 15: 47,499,849 (GRCm39) S2096P Het
Cyp2c70 A T 19: 40,156,016 (GRCm39) I178N probably damaging Het
Dmxl1 C T 18: 50,004,759 (GRCm39) Q936* probably null Het
Dnaaf3 A T 7: 4,533,814 (GRCm39) F94Y probably damaging Het
Eid2b C T 7: 27,977,480 (GRCm39) T92I possibly damaging Het
Ercc8 T C 13: 108,306,027 (GRCm39) probably null Het
Fank1 G A 7: 133,463,957 (GRCm39) probably null Het
Fbxw19 C A 9: 109,312,376 (GRCm39) E324* probably null Het
Fcnb A G 2: 27,968,361 (GRCm39) F199L possibly damaging Het
Gli1 T C 10: 127,173,260 (GRCm39) S133G probably null Het
Ighv5-8 TATACAT TAT 12: 113,618,583 (GRCm39) probably benign Het
Irak4 A G 15: 94,464,666 (GRCm39) D412G probably benign Het
Klhl20 A T 1: 160,936,997 (GRCm39) I126N probably damaging Het
Lama1 A G 17: 68,124,098 (GRCm39) E2841G Het
Lmtk3 T A 7: 45,435,975 (GRCm39) C85* probably null Het
Madd T C 2: 91,006,610 (GRCm39) Y328C probably damaging Het
Map1a G T 2: 121,137,737 (GRCm39) R2851L probably damaging Het
Mctp2 T C 7: 71,752,955 (GRCm39) D766G probably damaging Het
Mei4 T A 9: 81,809,638 (GRCm39) F240L probably damaging Het
Mgat3 A T 15: 80,096,472 (GRCm39) Y433F possibly damaging Het
Muc20 T A 16: 32,617,789 (GRCm39) probably benign Het
Nat8f1 A G 6: 85,887,738 (GRCm39) V74A probably benign Het
Nfe2l3 A G 6: 51,435,153 (GRCm39) D571G possibly damaging Het
Nlgn3 T C X: 100,352,390 (GRCm39) V179A probably damaging Het
Nphs1 T C 7: 30,163,284 (GRCm39) L480S probably damaging Het
Nr1d1 G C 11: 98,660,073 (GRCm39) R484G probably damaging Het
Or2ag2 A G 7: 106,485,280 (GRCm39) V248A probably damaging Het
Or4c122 T A 2: 89,079,351 (GRCm39) Y217F probably damaging Het
Or8j3b C T 2: 86,205,069 (GRCm39) R229H probably benign Het
Parp10 C A 15: 76,117,599 (GRCm39) C929F probably damaging Het
Pcdhb21 A G 18: 37,647,939 (GRCm39) E356G probably damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 (GRCm39) probably benign Het
Plch1 T A 3: 63,623,468 (GRCm39) R600* probably null Het
Ppp1r13l C A 7: 19,109,697 (GRCm39) T706K probably benign Het
Ppp1r16b G A 2: 158,593,098 (GRCm39) D226N probably damaging Het
Ppp1r16b G A 2: 158,598,942 (GRCm39) R334Q probably damaging Het
Ppp1r7 A G 1: 93,280,364 (GRCm39) Q188R probably benign Het
Pramel26 C A 4: 143,538,576 (GRCm39) A132S probably benign Het
Prkdc G T 16: 15,526,796 (GRCm39) probably null Het
Prss33 T C 17: 24,053,723 (GRCm39) D118G probably benign Het
Rab3gap2 T G 1: 184,983,281 (GRCm39) I473M probably damaging Het
Rbm44 A G 1: 91,080,103 (GRCm39) E97G probably damaging Het
Ros1 A G 10: 51,963,998 (GRCm39) M1775T probably benign Het
Ryr1 T A 7: 28,776,489 (GRCm39) M2216L probably damaging Het
Scn7a A G 2: 66,574,041 (GRCm39) probably benign Het
Slc31a2 G A 4: 62,210,896 (GRCm39) V12M probably benign Het
Slc35b1 T C 11: 95,278,646 (GRCm39) Y177H probably damaging Het
Slfn9 T A 11: 82,872,370 (GRCm39) M789L probably benign Het
Srf A G 17: 46,861,825 (GRCm39) probably null Het
Tank A G 2: 61,457,287 (GRCm39) E81G probably damaging Het
Tia1 T A 6: 86,402,685 (GRCm39) M241K probably benign Het
Tiam1 G T 16: 89,681,709 (GRCm39) S423* probably null Het
Tubg1 T G 11: 101,015,264 (GRCm39) S237A probably benign Het
Ubash3b G A 9: 40,942,785 (GRCm39) P358S probably benign Het
Vmn2r3 T C 3: 64,166,896 (GRCm39) E745G possibly damaging Het
Vmn2r4 T A 3: 64,314,391 (GRCm39) I197F probably benign Het
Vps37d C A 5: 135,105,386 (GRCm39) R79L probably damaging Het
Wdr7 T A 18: 63,910,768 (GRCm39) L720Q probably damaging Het
Xkr5 T C 8: 18,984,048 (GRCm39) N498S probably benign Het
Zc2hc1c A T 12: 85,337,084 (GRCm39) E247V probably benign Het
Other mutations in Galnt16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01916:Galnt16 APN 12 80,639,264 (GRCm39) splice site probably null
IGL02614:Galnt16 APN 12 80,623,337 (GRCm39) missense probably damaging 0.99
PIT4504001:Galnt16 UTSW 12 80,639,191 (GRCm39) nonsense probably null
R0032:Galnt16 UTSW 12 80,639,243 (GRCm39) missense probably damaging 1.00
R1109:Galnt16 UTSW 12 80,637,405 (GRCm39) missense probably benign
R1560:Galnt16 UTSW 12 80,648,566 (GRCm39) missense possibly damaging 0.77
R1595:Galnt16 UTSW 12 80,637,410 (GRCm39) missense probably damaging 0.99
R1991:Galnt16 UTSW 12 80,630,430 (GRCm39) missense probably damaging 1.00
R2103:Galnt16 UTSW 12 80,630,430 (GRCm39) missense probably damaging 1.00
R4866:Galnt16 UTSW 12 80,630,851 (GRCm39) missense probably damaging 1.00
R4972:Galnt16 UTSW 12 80,619,103 (GRCm39) nonsense probably null
R5140:Galnt16 UTSW 12 80,628,073 (GRCm39) missense possibly damaging 0.94
R5228:Galnt16 UTSW 12 80,630,822 (GRCm39) missense probably damaging 1.00
R5414:Galnt16 UTSW 12 80,630,822 (GRCm39) missense probably damaging 1.00
R5592:Galnt16 UTSW 12 80,635,293 (GRCm39) missense probably damaging 1.00
R6433:Galnt16 UTSW 12 80,622,677 (GRCm39) missense probably benign 0.44
R6634:Galnt16 UTSW 12 80,565,944 (GRCm39) start codon destroyed probably null 0.95
R7021:Galnt16 UTSW 12 80,626,826 (GRCm39) missense probably damaging 0.99
R7534:Galnt16 UTSW 12 80,643,909 (GRCm39) missense probably damaging 0.99
R7567:Galnt16 UTSW 12 80,628,084 (GRCm39) critical splice donor site probably null
R7681:Galnt16 UTSW 12 80,637,413 (GRCm39) missense probably damaging 1.00
R7802:Galnt16 UTSW 12 80,628,021 (GRCm39) missense probably damaging 1.00
R7983:Galnt16 UTSW 12 80,648,598 (GRCm39) missense probably benign 0.00
R8750:Galnt16 UTSW 12 80,644,879 (GRCm39) missense probably benign 0.18
R8944:Galnt16 UTSW 12 80,623,314 (GRCm39) missense probably damaging 1.00
R9386:Galnt16 UTSW 12 80,644,880 (GRCm39) missense probably damaging 0.99
Z1177:Galnt16 UTSW 12 80,648,584 (GRCm39) missense probably damaging 1.00
Z1177:Galnt16 UTSW 12 80,619,121 (GRCm39) missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- CAGAGAGGACTGTGACCATG -3'
(R):5'- TTAGCCATTTGGTCACAGGCTC -3'

Sequencing Primer
(F):5'- TGGGAACAGTCGTGAGGCC -3'
(R):5'- TACCTCAAAGGGCCCTTATGATG -3'
Posted On 2021-03-08