Incidental Mutation 'R8678:Dmxl1'
ID661551
Institutional Source Beutler Lab
Gene Symbol Dmxl1
Ensembl Gene ENSMUSG00000037416
Gene NameDmx-like 1
SynonymsC630007L23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R8678 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location49832670-49965473 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 49871692 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 936 (Q936*)
Ref Sequence ENSEMBL: ENSMUSP00000137871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041772] [ENSMUST00000180611]
Predicted Effect probably null
Transcript: ENSMUST00000041772
AA Change: Q936*
SMART Domains Protein: ENSMUSP00000045559
Gene: ENSMUSG00000037416
AA Change: Q936*

DomainStartEndE-ValueType
WD40 100 136 8.22e1 SMART
WD40 156 195 2.88e-1 SMART
WD40 218 266 8.29e-1 SMART
low complexity region 367 378 N/A INTRINSIC
WD40 464 505 1.53e2 SMART
Blast:WD40 719 772 1e-25 BLAST
WD40 957 999 1.1e1 SMART
Pfam:Rav1p_C 1102 1877 4.3e-84 PFAM
low complexity region 1922 1942 N/A INTRINSIC
low complexity region 1966 1975 N/A INTRINSIC
low complexity region 1993 2007 N/A INTRINSIC
low complexity region 2147 2158 N/A INTRINSIC
low complexity region 2371 2385 N/A INTRINSIC
low complexity region 2397 2410 N/A INTRINSIC
low complexity region 2449 2466 N/A INTRINSIC
WD40 2735 2770 1.07e1 SMART
WD40 2773 2813 3.7e0 SMART
WD40 2825 2867 1.07e0 SMART
WD40 2873 2912 1.05e-2 SMART
WD40 2915 2954 4.51e-7 SMART
Blast:WD40 2957 3005 9e-26 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000180611
AA Change: Q936*
SMART Domains Protein: ENSMUSP00000137871
Gene: ENSMUSG00000037416
AA Change: Q936*

DomainStartEndE-ValueType
WD40 100 136 8.22e1 SMART
WD40 156 195 2.88e-1 SMART
WD40 218 266 8.29e-1 SMART
low complexity region 367 378 N/A INTRINSIC
WD40 464 505 1.53e2 SMART
Blast:WD40 719 772 1e-25 BLAST
WD40 957 999 1.1e1 SMART
low complexity region 1195 1206 N/A INTRINSIC
low complexity region 1258 1271 N/A INTRINSIC
Pfam:Rav1p_C 1287 1876 9.4e-72 PFAM
low complexity region 1922 1942 N/A INTRINSIC
low complexity region 1966 1975 N/A INTRINSIC
low complexity region 1993 2007 N/A INTRINSIC
low complexity region 2147 2158 N/A INTRINSIC
low complexity region 2385 2398 N/A INTRINSIC
low complexity region 2437 2454 N/A INTRINSIC
WD40 2723 2758 1.07e1 SMART
WD40 2761 2801 3.7e0 SMART
WD40 2813 2855 1.07e0 SMART
WD40 2861 2900 1.05e-2 SMART
WD40 2903 2942 4.51e-7 SMART
Blast:WD40 2945 2993 9e-26 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.7%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WD repeat superfamily of proteins, which have regulatory functions. This gene is expressed in many tissue types including several types of eye tissue, and it has been associated with ocular phenotypes. In addition, it is upregulated in cultured cells that overexpress growth factor independence 1B, a transcription factor that is essential for hematopoietic cell development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 C T 16: 20,365,935 M991I probably benign Het
Acacb T A 5: 114,201,971 Y814* probably null Het
Alg2 A G 4: 47,474,108 F60S probably damaging Het
Arc A G 15: 74,671,690 L228P probably damaging Het
Bnip1 T A 17: 26,789,949 probably benign Het
Cacng4 A G 11: 107,735,099 L222P probably damaging Het
Calb2 A T 8: 110,147,643 V182E possibly damaging Het
Cfap44 A T 16: 44,475,273 I1645F probably damaging Het
Col6a5 T C 9: 105,934,352 D656G unknown Het
Csmd3 A G 15: 47,636,453 S2096P Het
Cyp2c70 A T 19: 40,167,572 I178N probably damaging Het
Dnaaf3 A T 7: 4,530,815 F94Y probably damaging Het
Doxl2 C T 6: 48,976,224 T361I possibly damaging Het
Eid2b C T 7: 28,278,055 T92I possibly damaging Het
Ercc8 T C 13: 108,169,493 probably null Het
Fank1 G A 7: 133,862,228 probably null Het
Fbxw19 C A 9: 109,483,308 E324* probably null Het
Fcnb A G 2: 28,078,349 F199L possibly damaging Het
Galnt16 A G 12: 80,584,048 D300G probably damaging Het
Gli1 T C 10: 127,337,391 S133G probably null Het
Gm13084 C A 4: 143,812,006 A132S probably benign Het
Ighv5-8 TATACAT TAT 12: 113,654,963 probably benign Het
Irak4 A G 15: 94,566,785 D412G probably benign Het
Klhl20 A T 1: 161,109,427 I126N probably damaging Het
Lama1 A G 17: 67,817,103 E2841G Het
Lmtk3 T A 7: 45,786,551 C85* probably null Het
Madd T C 2: 91,176,265 Y328C probably damaging Het
Map1a G T 2: 121,307,256 R2851L probably damaging Het
Mctp2 T C 7: 72,103,207 D766G probably damaging Het
Mei4 T A 9: 81,927,585 F240L probably damaging Het
Mgat3 A T 15: 80,212,271 Y433F possibly damaging Het
Muc20 T A 16: 32,797,419 probably benign Het
Nat8f1 A G 6: 85,910,756 V74A probably benign Het
Nfe2l3 A G 6: 51,458,173 D571G possibly damaging Het
Nlgn3 T C X: 101,308,784 V179A probably damaging Het
Nphs1 T C 7: 30,463,859 L480S probably damaging Het
Nr1d1 G C 11: 98,769,247 R484G probably damaging Het
Olfr1057 C T 2: 86,374,725 R229H probably benign Het
Olfr1228 T A 2: 89,249,007 Y217F probably damaging Het
Olfr706 A G 7: 106,886,073 V248A probably damaging Het
Parp10 C A 15: 76,233,399 C929F probably damaging Het
Pcdhb21 A G 18: 37,514,886 E356G probably damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Plch1 T A 3: 63,716,047 R600* probably null Het
Ppp1r13l C A 7: 19,375,772 T706K probably benign Het
Ppp1r16b G A 2: 158,751,178 D226N probably damaging Het
Ppp1r16b G A 2: 158,757,022 R334Q probably damaging Het
Ppp1r7 A G 1: 93,352,642 Q188R probably benign Het
Prkdc G T 16: 15,708,932 probably null Het
Prss33 T C 17: 23,834,749 D118G probably benign Het
Rab3gap2 T G 1: 185,251,084 I473M probably damaging Het
Rbm44 A G 1: 91,152,381 E97G probably damaging Het
Ros1 A G 10: 52,087,902 M1775T probably benign Het
Ryr1 T A 7: 29,077,064 M2216L probably damaging Het
Scn7a A G 2: 66,743,697 probably benign Het
Slc31a2 G A 4: 62,292,659 V12M probably benign Het
Slc35b1 T C 11: 95,387,820 Y177H probably damaging Het
Slfn9 T A 11: 82,981,544 M789L probably benign Het
Srf A G 17: 46,550,899 probably null Het
Tank A G 2: 61,626,943 E81G probably damaging Het
Tia1 T A 6: 86,425,703 M241K probably benign Het
Tiam1 G T 16: 89,884,821 S423* probably null Het
Tubg1 T G 11: 101,124,438 S237A probably benign Het
Ubash3b G A 9: 41,031,489 P358S probably benign Het
Vmn2r3 T C 3: 64,259,475 E745G possibly damaging Het
Vmn2r4 T A 3: 64,406,970 I197F probably benign Het
Vps37d C A 5: 135,076,532 R79L probably damaging Het
Wdr7 T A 18: 63,777,697 L720Q probably damaging Het
Xkr5 T C 8: 18,934,032 N498S probably benign Het
Zc2hc1c A T 12: 85,290,310 E247V probably benign Het
Other mutations in Dmxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Dmxl1 APN 18 49851467 missense probably damaging 1.00
IGL00668:Dmxl1 APN 18 49939553 missense possibly damaging 0.64
IGL00740:Dmxl1 APN 18 49917668 missense probably benign 0.00
IGL00969:Dmxl1 APN 18 49912725 missense probably benign 0.02
IGL01113:Dmxl1 APN 18 49912751 missense probably benign 0.01
IGL01384:Dmxl1 APN 18 49857334 missense probably benign
IGL01475:Dmxl1 APN 18 49871714 missense probably damaging 1.00
IGL01559:Dmxl1 APN 18 49920938 missense probably damaging 0.99
IGL01578:Dmxl1 APN 18 49962205 missense probably damaging 1.00
IGL01632:Dmxl1 APN 18 49863025 missense probably damaging 0.99
IGL01814:Dmxl1 APN 18 49864868 missense probably damaging 1.00
IGL01843:Dmxl1 APN 18 49878382 nonsense probably null
IGL01933:Dmxl1 APN 18 49877785 missense probably benign 0.17
IGL01952:Dmxl1 APN 18 49890654 missense probably benign 0.11
IGL02120:Dmxl1 APN 18 49894178 missense possibly damaging 0.83
IGL02162:Dmxl1 APN 18 49961163 missense probably benign 0.00
IGL02213:Dmxl1 APN 18 49877674 splice site probably benign
IGL02261:Dmxl1 APN 18 49840499 missense possibly damaging 0.85
IGL02689:Dmxl1 APN 18 49864895 missense probably damaging 1.00
IGL02892:Dmxl1 APN 18 49859120 missense probably damaging 0.96
IGL03232:Dmxl1 APN 18 49878180 missense probably benign 0.01
IGL03258:Dmxl1 APN 18 49920893 missense probably damaging 1.00
IGL03298:Dmxl1 APN 18 49864818 missense probably benign
carnivora UTSW 18 49864383 missense probably damaging 0.99
hibiscus UTSW 18 49889467 missense probably damaging 1.00
pitcher UTSW 18 49864148 missense probably damaging 1.00
R3889_Dmxl1_217 UTSW 18 49878259 missense probably damaging 1.00
PIT4810001:Dmxl1 UTSW 18 49931963 missense probably damaging 1.00
R0001:Dmxl1 UTSW 18 49888897 splice site probably benign
R0027:Dmxl1 UTSW 18 49957295 splice site probably benign
R0042:Dmxl1 UTSW 18 49864035 missense probably benign 0.03
R0042:Dmxl1 UTSW 18 49864035 missense probably benign 0.03
R0046:Dmxl1 UTSW 18 49878082 missense probably benign 0.22
R0046:Dmxl1 UTSW 18 49878082 missense probably benign 0.22
R0257:Dmxl1 UTSW 18 49955803 splice site probably benign
R0349:Dmxl1 UTSW 18 49879282 missense probably damaging 0.99
R0390:Dmxl1 UTSW 18 49879362 missense probably benign 0.14
R0511:Dmxl1 UTSW 18 49891467 nonsense probably null
R0539:Dmxl1 UTSW 18 49857430 splice site probably benign
R0542:Dmxl1 UTSW 18 49893694 missense probably benign 0.05
R0587:Dmxl1 UTSW 18 49935307 missense probably benign 0.39
R0635:Dmxl1 UTSW 18 49851423 splice site probably benign
R0744:Dmxl1 UTSW 18 49833148 missense probably damaging 1.00
R0836:Dmxl1 UTSW 18 49833148 missense probably damaging 1.00
R0845:Dmxl1 UTSW 18 49893402 missense probably damaging 1.00
R1218:Dmxl1 UTSW 18 49893611 missense probably damaging 1.00
R1278:Dmxl1 UTSW 18 49893225 missense probably benign
R1313:Dmxl1 UTSW 18 49878483 missense probably damaging 1.00
R1313:Dmxl1 UTSW 18 49878483 missense probably damaging 1.00
R1349:Dmxl1 UTSW 18 49888853 missense probably damaging 1.00
R1453:Dmxl1 UTSW 18 49857249 missense probably benign 0.05
R1522:Dmxl1 UTSW 18 49852367 missense probably benign 0.05
R1629:Dmxl1 UTSW 18 49859286 critical splice donor site probably null
R1638:Dmxl1 UTSW 18 49890767 nonsense probably null
R1646:Dmxl1 UTSW 18 49962261 missense probably damaging 1.00
R1719:Dmxl1 UTSW 18 49934637 missense probably damaging 1.00
R1732:Dmxl1 UTSW 18 49893444 nonsense probably null
R1732:Dmxl1 UTSW 18 49902988 missense probably benign
R1886:Dmxl1 UTSW 18 49859135 missense probably benign 0.09
R1887:Dmxl1 UTSW 18 49859135 missense probably benign 0.09
R1895:Dmxl1 UTSW 18 49955914 splice site probably null
R1911:Dmxl1 UTSW 18 49878163 missense probably benign 0.00
R2020:Dmxl1 UTSW 18 49889558 nonsense probably null
R2116:Dmxl1 UTSW 18 49878817 missense probably damaging 1.00
R2196:Dmxl1 UTSW 18 49917631 missense probably benign 0.00
R2206:Dmxl1 UTSW 18 49894094 missense probably benign 0.12
R2216:Dmxl1 UTSW 18 49893923 missense probably benign 0.00
R2255:Dmxl1 UTSW 18 49846639 missense probably benign 0.34
R2333:Dmxl1 UTSW 18 49919976 splice site probably null
R2343:Dmxl1 UTSW 18 49890678 missense probably damaging 1.00
R2496:Dmxl1 UTSW 18 49880791 missense possibly damaging 0.51
R3757:Dmxl1 UTSW 18 49935317 missense probably damaging 0.98
R3758:Dmxl1 UTSW 18 49935317 missense probably damaging 0.98
R3783:Dmxl1 UTSW 18 49865122 missense probably damaging 1.00
R3786:Dmxl1 UTSW 18 49865122 missense probably damaging 1.00
R3787:Dmxl1 UTSW 18 49865122 missense probably damaging 1.00
R3885:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3886:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3887:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3888:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3889:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R4014:Dmxl1 UTSW 18 49863962 missense probably benign
R4033:Dmxl1 UTSW 18 49851431 missense possibly damaging 0.95
R4096:Dmxl1 UTSW 18 49961197 missense probably damaging 1.00
R4366:Dmxl1 UTSW 18 49878017 nonsense probably null
R4406:Dmxl1 UTSW 18 49889553 missense probably damaging 1.00
R4412:Dmxl1 UTSW 18 49848761 missense probably benign
R4454:Dmxl1 UTSW 18 49893332 missense probably benign 0.01
R4459:Dmxl1 UTSW 18 49961216 missense possibly damaging 0.80
R4569:Dmxl1 UTSW 18 49852360 missense probably damaging 1.00
R4570:Dmxl1 UTSW 18 49852360 missense probably damaging 1.00
R4606:Dmxl1 UTSW 18 49962181 missense probably damaging 0.98
R4649:Dmxl1 UTSW 18 49878631 missense probably damaging 0.99
R4683:Dmxl1 UTSW 18 49878021 missense probably damaging 1.00
R4782:Dmxl1 UTSW 18 49862992 missense probably damaging 1.00
R4878:Dmxl1 UTSW 18 49851476 missense probably damaging 1.00
R4879:Dmxl1 UTSW 18 49889467 missense probably damaging 1.00
R4881:Dmxl1 UTSW 18 49957281 intron probably benign
R4885:Dmxl1 UTSW 18 49878795 missense probably damaging 0.99
R4916:Dmxl1 UTSW 18 49877697 missense probably damaging 1.00
R5022:Dmxl1 UTSW 18 49895127 missense probably damaging 0.99
R5056:Dmxl1 UTSW 18 49870923 missense probably benign 0.00
R5177:Dmxl1 UTSW 18 49893584 missense probably damaging 0.99
R5342:Dmxl1 UTSW 18 49951235 missense probably damaging 0.96
R5421:Dmxl1 UTSW 18 49863119 critical splice donor site probably null
R5433:Dmxl1 UTSW 18 49867899 splice site probably null
R5484:Dmxl1 UTSW 18 49889464 missense probably damaging 1.00
R5598:Dmxl1 UTSW 18 49864478 missense probably benign 0.04
R5633:Dmxl1 UTSW 18 49877697 missense probably damaging 1.00
R5638:Dmxl1 UTSW 18 49891626 missense possibly damaging 0.95
R5694:Dmxl1 UTSW 18 49894257 missense probably damaging 1.00
R5696:Dmxl1 UTSW 18 49931941 nonsense probably null
R5706:Dmxl1 UTSW 18 49957395 critical splice donor site probably null
R5745:Dmxl1 UTSW 18 49846586 missense probably benign
R5876:Dmxl1 UTSW 18 49870984 missense possibly damaging 0.70
R6054:Dmxl1 UTSW 18 49857386 missense probably benign 0.00
R6145:Dmxl1 UTSW 18 49912766 missense possibly damaging 0.90
R6189:Dmxl1 UTSW 18 49893335 missense probably benign 0.33
R6213:Dmxl1 UTSW 18 49863015 missense possibly damaging 0.93
R6219:Dmxl1 UTSW 18 49902367 missense probably damaging 0.99
R6221:Dmxl1 UTSW 18 49871732 missense probably damaging 0.96
R6276:Dmxl1 UTSW 18 49846586 missense probably benign
R6319:Dmxl1 UTSW 18 49852300 missense probably benign 0.00
R6426:Dmxl1 UTSW 18 49864578 missense probably damaging 0.99
R6567:Dmxl1 UTSW 18 49859179 missense probably damaging 0.99
R6739:Dmxl1 UTSW 18 49878246 missense probably benign 0.03
R6743:Dmxl1 UTSW 18 49880780 missense possibly damaging 0.95
R6776:Dmxl1 UTSW 18 49893974 missense probably damaging 1.00
R6827:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6828:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6829:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6830:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6833:Dmxl1 UTSW 18 49955823 missense probably damaging 0.99
R6834:Dmxl1 UTSW 18 49955823 missense probably damaging 0.99
R6856:Dmxl1 UTSW 18 49852288 nonsense probably null
R6857:Dmxl1 UTSW 18 49864835 missense probably damaging 0.99
R6881:Dmxl1 UTSW 18 49935305 missense probably benign 0.00
R6882:Dmxl1 UTSW 18 49843784 critical splice acceptor site probably null
R6892:Dmxl1 UTSW 18 49920902 missense probably damaging 0.98
R6897:Dmxl1 UTSW 18 49851495 missense probably null 0.99
R6897:Dmxl1 UTSW 18 49863057 missense possibly damaging 0.51
R6917:Dmxl1 UTSW 18 49864148 missense probably damaging 1.00
R7192:Dmxl1 UTSW 18 49955853 missense probably damaging 0.99
R7447:Dmxl1 UTSW 18 49864614 missense probably damaging 0.99
R7460:Dmxl1 UTSW 18 49878612 missense probably benign 0.00
R7570:Dmxl1 UTSW 18 49893957 missense possibly damaging 0.82
R7626:Dmxl1 UTSW 18 49902794 missense probably benign
R7629:Dmxl1 UTSW 18 49859270 missense probably damaging 1.00
R7644:Dmxl1 UTSW 18 49893552 missense probably benign
R7688:Dmxl1 UTSW 18 49955871 missense probably benign 0.03
R7689:Dmxl1 UTSW 18 49846618 missense probably benign 0.00
R7712:Dmxl1 UTSW 18 49893461 missense probably damaging 0.99
R7808:Dmxl1 UTSW 18 49878315 missense probably benign 0.00
R7834:Dmxl1 UTSW 18 49920977 missense probably damaging 1.00
R7848:Dmxl1 UTSW 18 49840490 missense possibly damaging 0.88
R7849:Dmxl1 UTSW 18 49961147 missense probably benign 0.00
R7881:Dmxl1 UTSW 18 49864383 missense probably damaging 0.99
R7884:Dmxl1 UTSW 18 49893407 missense possibly damaging 0.65
R8073:Dmxl1 UTSW 18 49878433 missense probably damaging 1.00
R8089:Dmxl1 UTSW 18 49888830 missense probably damaging 0.99
R8266:Dmxl1 UTSW 18 49843811 missense probably benign 0.17
R8371:Dmxl1 UTSW 18 49898714 missense probably benign 0.08
R8402:Dmxl1 UTSW 18 49878326 nonsense probably null
R8402:Dmxl1 UTSW 18 49878327 missense probably benign 0.09
R8402:Dmxl1 UTSW 18 49878342 missense probably benign
R8423:Dmxl1 UTSW 18 49865116 missense probably damaging 1.00
R8702:Dmxl1 UTSW 18 49859135 missense probably benign 0.09
R8749:Dmxl1 UTSW 18 49955870 missense probably damaging 1.00
R8813:Dmxl1 UTSW 18 49957339 missense probably damaging 0.99
R8877:Dmxl1 UTSW 18 49878225 missense possibly damaging 0.55
R8945:Dmxl1 UTSW 18 49939572 missense probably damaging 1.00
R8971:Dmxl1 UTSW 18 49864508 missense possibly damaging 0.96
R8971:Dmxl1 UTSW 18 49893674 missense probably damaging 1.00
R8978:Dmxl1 UTSW 18 49922612 missense probably benign 0.37
R8987:Dmxl1 UTSW 18 49893852 missense
R9011:Dmxl1 UTSW 18 49864173 missense probably damaging 1.00
RF009:Dmxl1 UTSW 18 49893394 missense probably damaging 0.96
X0025:Dmxl1 UTSW 18 49864368 missense probably damaging 0.98
X0066:Dmxl1 UTSW 18 49919899 missense probably damaging 1.00
Z1088:Dmxl1 UTSW 18 49920965 missense probably benign
Z1188:Dmxl1 UTSW 18 49868003 missense probably damaging 0.96
Z1189:Dmxl1 UTSW 18 49868003 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCCTTCCCATTGTTTATAGAGTGAG -3'
(R):5'- ACTGCTTTGTATGTACTTCAGAGTG -3'

Sequencing Primer
(F):5'- ACAATACTTATTCGTAAAGGATTCCC -3'
(R):5'- ACTTCAGAGTGAGGTACAGTATTTAC -3'
Posted On2021-03-08