Incidental Mutation 'R8678:Nlgn3'
ID661554
Institutional Source Beutler Lab
Gene Symbol Nlgn3
Ensembl Gene ENSMUSG00000031302
Gene Nameneuroligin 3
SynonymsNL3, A230085M13Rik, HNL3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8678 (G1)
Quality Score221.999
Status Not validated
ChromosomeX
Chromosomal Location101299168-101325963 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101308784 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 179 (V179A)
Ref Sequence ENSEMBL: ENSMUSP00000066304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065858] [ENSMUST00000118111] [ENSMUST00000130555] [ENSMUST00000151528]
Predicted Effect probably damaging
Transcript: ENSMUST00000065858
AA Change: V179A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066304
Gene: ENSMUSG00000031302
AA Change: V179A

DomainStartEndE-ValueType
Pfam:COesterase 16 601 2.3e-194 PFAM
Pfam:Abhydrolase_3 180 342 1.7e-7 PFAM
transmembrane domain 685 707 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118111
AA Change: V65A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113863
Gene: ENSMUSG00000031302
AA Change: V65A

DomainStartEndE-ValueType
Pfam:COesterase 3 487 3.6e-161 PFAM
Pfam:Abhydrolase_3 66 232 2.4e-7 PFAM
transmembrane domain 571 593 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130555
AA Change: V159A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122213
Gene: ENSMUSG00000031302
AA Change: V159A

DomainStartEndE-ValueType
Pfam:COesterase 16 510 4.6e-179 PFAM
Pfam:Abhydrolase_3 160 323 1.5e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000151528
AA Change: V199A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123283
Gene: ENSMUSG00000031302
AA Change: V199A

DomainStartEndE-ValueType
Pfam:COesterase 16 621 3.4e-207 PFAM
Pfam:Abhydrolase_3 200 363 1.2e-6 PFAM
transmembrane domain 705 727 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of neuronal cell surface proteins. Members of this family may act as splice site-specific ligands for beta-neurexins and may be involved in the formation and remodeling of central nervous system synapses. Mutations in this gene may be associated with autism and Asperger syndrome. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mice show impaired context and cued conditioning, hyperactivity, altered social behavior, less vocalization, smaller brains, and impaired olfaction. Males carrying a knock-in allele show impaired social interaction, and enhanced spatial learning and inhibitory synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 C T 16: 20,365,935 M991I probably benign Het
Acacb T A 5: 114,201,971 Y814* probably null Het
Alg2 A G 4: 47,474,108 F60S probably damaging Het
Arc A G 15: 74,671,690 L228P probably damaging Het
Cacng4 A G 11: 107,735,099 L222P probably damaging Het
Calb2 A T 8: 110,147,643 V182E possibly damaging Het
Cfap44 A T 16: 44,475,273 I1645F probably damaging Het
Col6a5 T C 9: 105,934,352 D656G unknown Het
Csmd3 A G 15: 47,636,453 S2096P Het
Cyp2c70 A T 19: 40,167,572 I178N probably damaging Het
Dmxl1 C T 18: 49,871,692 Q936* probably null Het
Dnaaf3 A T 7: 4,530,815 F94Y probably damaging Het
Doxl2 C T 6: 48,976,224 T361I possibly damaging Het
Eid2b C T 7: 28,278,055 T92I possibly damaging Het
Ercc8 T C 13: 108,169,493 probably null Het
Fank1 G A 7: 133,862,228 probably null Het
Fbxw19 C A 9: 109,483,308 E324* probably null Het
Fcnb A G 2: 28,078,349 F199L possibly damaging Het
Galnt16 A G 12: 80,584,048 D300G probably damaging Het
Gli1 T C 10: 127,337,391 S133G probably null Het
Gm13084 C A 4: 143,812,006 A132S probably benign Het
Ighv5-8 TATACAT TAT 12: 113,654,963 probably benign Het
Irak4 A G 15: 94,566,785 D412G probably benign Het
Klhl20 A T 1: 161,109,427 I126N probably damaging Het
Lama1 A G 17: 67,817,103 E2841G Het
Lmtk3 T A 7: 45,786,551 C85* probably null Het
Madd T C 2: 91,176,265 Y328C probably damaging Het
Map1a G T 2: 121,307,256 R2851L probably damaging Het
Mctp2 T C 7: 72,103,207 D766G probably damaging Het
Mei4 T A 9: 81,927,585 F240L probably damaging Het
Mgat3 A T 15: 80,212,271 Y433F possibly damaging Het
Muc20 T A 16: 32,797,419 probably benign Het
Nat8f1 A G 6: 85,910,756 V74A probably benign Het
Nfe2l3 A G 6: 51,458,173 D571G possibly damaging Het
Nphs1 T C 7: 30,463,859 L480S probably damaging Het
Nr1d1 G C 11: 98,769,247 R484G probably damaging Het
Olfr1057 C T 2: 86,374,725 R229H probably benign Het
Olfr1228 T A 2: 89,249,007 Y217F probably damaging Het
Olfr706 A G 7: 106,886,073 V248A probably damaging Het
Parp10 C A 15: 76,233,399 C929F probably damaging Het
Pcdhb21 A G 18: 37,514,886 E356G probably damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Plch1 T A 3: 63,716,047 R600* probably null Het
Ppp1r13l C A 7: 19,375,772 T706K probably benign Het
Ppp1r16b G A 2: 158,751,178 D226N probably damaging Het
Ppp1r16b G A 2: 158,757,022 R334Q probably damaging Het
Ppp1r7 A G 1: 93,352,642 Q188R probably benign Het
Prkdc G T 16: 15,708,932 probably null Het
Prss33 T C 17: 23,834,749 D118G probably benign Het
Rab3gap2 T G 1: 185,251,084 I473M probably damaging Het
Rbm44 A G 1: 91,152,381 E97G probably damaging Het
Ros1 A G 10: 52,087,902 M1775T probably benign Het
Ryr1 T A 7: 29,077,064 M2216L probably damaging Het
Slc31a2 G A 4: 62,292,659 V12M probably benign Het
Slc35b1 T C 11: 95,387,820 Y177H probably damaging Het
Slfn9 T A 11: 82,981,544 M789L probably benign Het
Srf A G 17: 46,550,899 probably null Het
Tank A G 2: 61,626,943 E81G probably damaging Het
Tia1 T A 6: 86,425,703 M241K probably benign Het
Tiam1 G T 16: 89,884,821 S423* probably null Het
Tubg1 T G 11: 101,124,438 S237A probably benign Het
Ubash3b G A 9: 41,031,489 P358S probably benign Het
Vmn2r3 T C 3: 64,259,475 E745G possibly damaging Het
Vmn2r4 T A 3: 64,406,970 I197F probably benign Het
Vps37d C A 5: 135,076,532 R79L probably damaging Het
Wdr7 T A 18: 63,777,697 L720Q probably damaging Het
Xkr5 T C 8: 18,934,032 N498S probably benign Het
Zc2hc1c A T 12: 85,290,310 E247V probably benign Het
Other mutations in Nlgn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01128:Nlgn3 APN X 101320092 missense probably benign 0.28
IGL01327:Nlgn3 APN X 101318622 missense probably benign 0.08
IGL01414:Nlgn3 APN X 101302260 missense probably benign 0.00
R1296:Nlgn3 UTSW X 101308916 splice site probably benign
R1794:Nlgn3 UTSW X 101320033 missense probably benign 0.30
R5144:Nlgn3 UTSW X 101318285 missense probably benign 0.21
R5145:Nlgn3 UTSW X 101318285 missense probably benign 0.21
R5146:Nlgn3 UTSW X 101318285 missense probably benign 0.21
R8677:Nlgn3 UTSW X 101308784 missense probably damaging 1.00
R8684:Nlgn3 UTSW X 101319819 nonsense probably null
R8696:Nlgn3 UTSW X 101308784 missense probably damaging 1.00
Z1176:Nlgn3 UTSW X 101317982 missense probably benign 0.30
Z1176:Nlgn3 UTSW X 101319877 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCCAGTACTTCAACTCCG -3'
(R):5'- TTAACACCAGCGAGAGATCTAGGAC -3'

Sequencing Primer
(F):5'- AGTACTTCAACTCCGGGCCTAG -3'
(R):5'- AGGACTACCTAAATTGACTTCCCTGG -3'
Posted On2021-03-08