Incidental Mutation 'R8679:4930430A15Rik'
ID 661562
Institutional Source Beutler Lab
Gene Symbol 4930430A15Rik
Ensembl Gene ENSMUSG00000027157
Gene Name RIKEN cDNA 4930430A15 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock # R8679 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 111162061-111229602 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 111229222 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 64 (M64K)
Ref Sequence ENSEMBL: ENSMUSP00000028577 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028577] [ENSMUST00000099620] [ENSMUST00000216421] [ENSMUST00000217539]
AlphaFold Q05AC5
Predicted Effect possibly damaging
Transcript: ENSMUST00000028577
AA Change: M64K

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000028577
Gene: ENSMUSG00000027157
AA Change: M64K

DomainStartEndE-ValueType
ANK 78 107 1.61e-4 SMART
ANK 111 140 3.6e-2 SMART
ANK 144 173 4.89e-4 SMART
ANK 177 206 4.03e-5 SMART
ANK 210 239 8.72e-1 SMART
Blast:ANK 243 272 4e-12 BLAST
low complexity region 460 472 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099620
SMART Domains Protein: ENSMUSP00000097215
Gene: ENSMUSG00000074966

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 9.8e-37 PFAM
Pfam:7tm_1 41 287 5.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216421
Predicted Effect probably benign
Transcript: ENSMUST00000217539
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency 98% (91/93)
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 T C 16: 20,333,729 T1356A possibly damaging Het
Ace3 A G 11: 105,995,875 T154A probably benign Het
Arhgap31 C A 16: 38,602,604 Q1033H probably damaging Het
BC067074 A G 13: 113,351,629 R9G Het
C1qtnf1 C T 11: 118,446,514 R57* probably null Het
Cacna1g T C 11: 94,429,136 T1405A probably damaging Het
Cacna1i A G 15: 80,375,810 probably benign Het
Cdca4 T A 12: 112,822,114 probably null Het
Cpa4 T A 6: 30,585,159 M314K probably damaging Het
Cpn2 A T 16: 30,259,267 S539T possibly damaging Het
Crebbp A G 16: 4,084,458 S2306P probably damaging Het
Dcaf5 T C 12: 80,339,033 H773R probably benign Het
Dcun1d2 A T 8: 13,261,406 D194E probably benign Het
Dnah1 G T 14: 31,267,810 R3250S possibly damaging Het
Dnajc25 A C 4: 59,020,195 K206T possibly damaging Het
Dnajc27 T C 12: 4,096,325 L118P possibly damaging Het
Etl4 C T 2: 20,709,477 T129I probably damaging Het
Faap100 A G 11: 120,372,177 I785T probably damaging Het
Fam227b A T 2: 125,989,008 D425E probably benign Het
Fat4 C G 3: 39,010,693 L4933V probably damaging Het
Fbrsl1 A G 5: 110,378,220 F39L probably damaging Het
Fezf1 A G 6: 23,247,770 V102A probably benign Het
Gabra2 T C 5: 71,012,697 probably benign Het
Garnl3 C A 2: 33,026,094 R346L probably damaging Het
Grin2a A T 16: 9,585,225 I799N possibly damaging Het
Hspa4 A G 11: 53,269,864 F462L probably damaging Het
Iars C A 13: 49,703,199 probably benign Het
Igkv6-32 C T 6: 70,074,079 V98M possibly damaging Het
Il31ra A G 13: 112,525,838 F560S possibly damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kif2a G A 13: 106,979,541 T299I probably damaging Het
Leo1 T A 9: 75,466,262 Y656* probably null Het
Lpcat2 T A 8: 92,909,236 V422D probably damaging Het
Lrrcc1 T A 3: 14,536,024 S39T probably benign Het
Macf1 A T 4: 123,512,076 S341T probably benign Het
Mc2r T A 18: 68,407,808 Y138F probably damaging Het
Mepe A G 5: 104,337,888 N298S possibly damaging Het
Mmp15 C A 8: 95,366,354 N120K possibly damaging Het
Mrps9 A G 1: 42,879,755 R106G probably damaging Het
Muc16 T A 9: 18,646,448 M2850L unknown Het
Mxra8 T A 4: 155,842,665 I352N probably damaging Het
Myo16 G A 8: 10,361,042 V167I unknown Het
Neb T C 2: 52,325,039 D209G probably damaging Het
Nlgn2 A G 11: 69,825,483 V744A probably benign Het
Notch2 A G 3: 98,121,902 probably null Het
Nr1d1 G C 11: 98,769,247 R484G probably damaging Het
Olfr180 G A 16: 58,916,480 R54C probably benign Het
Olfr296-ps1 A T 7: 86,561,939 H69L unknown Het
Olfr826 T C 10: 130,180,833 I16V probably benign Het
Olfr988 T C 2: 85,353,609 T106A probably benign Het
Oxa1l A G 14: 54,367,791 probably null Het
Piwil4 T C 9: 14,705,026 D15G Het
Plcz1 C A 6: 140,003,886 W461L probably damaging Het
Plek A T 11: 16,994,676 I118N probably damaging Het
Poc1b C A 10: 99,164,866 probably benign Het
Ppp1r16b G A 2: 158,751,178 D226N probably damaging Het
Prss36 T C 7: 127,933,463 T739A possibly damaging Het
Psme2 A T 14: 55,589,617 probably null Het
Ptprb T G 10: 116,367,590 V1802G probably damaging Het
Rabep2 C A 7: 126,435,676 Y84* probably null Het
Rbbp6 T G 7: 123,001,293 S1508A unknown Het
Rel A T 11: 23,742,430 D534E probably benign Het
Rpgrip1 G A 14: 52,159,395 S1258N probably damaging Het
Rprml T C 11: 103,650,127 L116P probably damaging Het
Rsph10b A G 5: 143,950,294 T323A possibly damaging Het
Rtn4rl1 A G 11: 75,265,273 H177R probably damaging Het
Sag A G 1: 87,810,310 T24A probably benign Het
Scgb2b26 G T 7: 33,944,359 T52N probably damaging Het
Scn10a T C 9: 119,672,128 I197V probably damaging Het
Sec24c T A 14: 20,692,859 V1003D possibly damaging Het
Sirt2 G A 7: 28,771,836 G30E probably damaging Het
Slc13a5 T A 11: 72,259,093 Q197L probably benign Het
Slc44a3 A T 3: 121,490,269 S445T probably damaging Het
Slc7a7 A T 14: 54,372,992 V399E probably benign Het
Smarcad1 T A 6: 65,111,881 D1000E probably benign Het
Sorcs2 G T 5: 36,039,313 Q663K probably benign Het
Stat4 A G 1: 52,079,832 R345G probably null Het
Sycp2 G A 2: 178,350,975 R1261C probably damaging Het
Tcf19 T C 17: 35,514,484 I259V probably benign Het
Thada T A 17: 84,229,209 R1636S probably benign Het
Tnrc6c T C 11: 117,714,135 L32P probably benign Het
Tonsl G A 15: 76,632,876 T881I probably benign Het
Tonsl A C 15: 76,634,063 C570G probably damaging Het
Ube2o C A 11: 116,541,447 E898* probably null Het
Usp5 T C 6: 124,817,431 H762R possibly damaging Het
Vmn2r15 A G 5: 109,286,913 S642P probably benign Het
Vmn2r23 T C 6: 123,713,472 W436R probably damaging Het
Vps13d A C 4: 145,085,407 I3343M Het
Wbp11 T C 6: 136,822,934 K83E probably damaging Het
Zfp26 T A 9: 20,444,905 N36Y possibly damaging Het
Zfp57 T A 17: 37,010,046 I264N probably damaging Het
Other mutations in 4930430A15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:4930430A15Rik APN 2 111220762 missense probably damaging 0.98
IGL01403:4930430A15Rik APN 2 111229170 unclassified probably benign
IGL01431:4930430A15Rik APN 2 111225395 unclassified probably benign
IGL01601:4930430A15Rik APN 2 111193478 missense unknown
IGL01649:4930430A15Rik APN 2 111214576 splice site probably benign
IGL02355:4930430A15Rik APN 2 111211651 splice site probably benign
IGL02362:4930430A15Rik APN 2 111211651 splice site probably benign
IGL02485:4930430A15Rik APN 2 111228325 missense probably damaging 0.97
IGL02620:4930430A15Rik APN 2 111211625 missense probably benign 0.00
IGL03156:4930430A15Rik APN 2 111200412 missense possibly damaging 0.90
IGL02980:4930430A15Rik UTSW 2 111164473 missense unknown
R0577:4930430A15Rik UTSW 2 111194349 missense probably benign 0.27
R0638:4930430A15Rik UTSW 2 111200418 missense probably damaging 0.96
R0645:4930430A15Rik UTSW 2 111214583 critical splice donor site probably null
R0671:4930430A15Rik UTSW 2 111204137 missense possibly damaging 0.93
R0829:4930430A15Rik UTSW 2 111198105 missense possibly damaging 0.92
R1464:4930430A15Rik UTSW 2 111225403 critical splice donor site probably null
R1464:4930430A15Rik UTSW 2 111225403 critical splice donor site probably null
R1486:4930430A15Rik UTSW 2 111200358 missense possibly damaging 0.84
R1509:4930430A15Rik UTSW 2 111218627 missense probably benign
R1672:4930430A15Rik UTSW 2 111220774 missense probably benign 0.00
R2073:4930430A15Rik UTSW 2 111200418 missense probably damaging 0.96
R2074:4930430A15Rik UTSW 2 111200418 missense probably damaging 0.96
R2075:4930430A15Rik UTSW 2 111200418 missense probably damaging 0.96
R2899:4930430A15Rik UTSW 2 111220670 splice site probably benign
R2965:4930430A15Rik UTSW 2 111204019 missense possibly damaging 0.61
R3110:4930430A15Rik UTSW 2 111228054 missense probably damaging 1.00
R3112:4930430A15Rik UTSW 2 111228054 missense probably damaging 1.00
R4489:4930430A15Rik UTSW 2 111220702 missense probably benign 0.31
R4821:4930430A15Rik UTSW 2 111204145 critical splice acceptor site probably null
R4925:4930430A15Rik UTSW 2 111218616 missense probably benign 0.41
R5045:4930430A15Rik UTSW 2 111193459 missense unknown
R5057:4930430A15Rik UTSW 2 111225421 missense probably benign 0.12
R5128:4930430A15Rik UTSW 2 111164329 nonsense probably null
R5250:4930430A15Rik UTSW 2 111228077 missense possibly damaging 0.87
R5333:4930430A15Rik UTSW 2 111194337 missense possibly damaging 0.92
R5376:4930430A15Rik UTSW 2 111215599 missense probably benign 0.44
R5677:4930430A15Rik UTSW 2 111211565 missense probably benign
R5722:4930430A15Rik UTSW 2 111204123 missense probably benign
R5735:4930430A15Rik UTSW 2 111225492 nonsense probably null
R6170:4930430A15Rik UTSW 2 111227948 missense probably benign 0.03
R6366:4930430A15Rik UTSW 2 111169592 critical splice donor site probably null
R6496:4930430A15Rik UTSW 2 111164472 missense unknown
R6654:4930430A15Rik UTSW 2 111171884 missense unknown
R6983:4930430A15Rik UTSW 2 111228250 critical splice donor site probably null
R7371:4930430A15Rik UTSW 2 111193481 missense unknown
R7958:4930430A15Rik UTSW 2 111170325 missense unknown
R8421:4930430A15Rik UTSW 2 111218610 nonsense probably null
R8495:4930430A15Rik UTSW 2 111229410 start codon destroyed probably null 0.33
R8534:4930430A15Rik UTSW 2 111228035 missense possibly damaging 0.92
R8671:4930430A15Rik UTSW 2 111229532 unclassified probably benign
R8743:4930430A15Rik UTSW 2 111169672 missense unknown
R8983:4930430A15Rik UTSW 2 111200356 missense probably benign 0.00
R9213:4930430A15Rik UTSW 2 111190354 missense unknown
R9457:4930430A15Rik UTSW 2 111170286 missense unknown
Predicted Primers PCR Primer
(F):5'- ATGCTAAGGATCCACGGGAG -3'
(R):5'- AGTGAGACCAGTAGCCTCAATTATG -3'

Sequencing Primer
(F):5'- GAAGGAGCATAGAGTGGACTTCCTC -3'
(R):5'- CCAGTAGCCTCAATTATGAAGAAG -3'
Posted On 2021-03-08