Mutagenetix > Incidental Mutations

Incidental Mutation 'R8679:Notch2'

661568

Institutional Source

Beutler Lab

Gene Symbol

Notch2

Ensembl Gene

ENSMUSG00000027878

Gene Name

notch 2

Synonyms

N2, Motch B

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8679 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

98013527-98150361 bp(+) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

A to G at 98121902 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000078741 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079812]

AlphaFold

O35516

Predicted Effect

probably null
Transcript: ENSMUST00000079812

SMART Domains

Protein: ENSMUSP00000078741
Gene: ENSMUSG00000027878

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
EGF	27	63	5.79e-2	SMART
EGF	67	102	1.54e-6	SMART
EGF	108	143	6.25e-7	SMART
EGF	147	180	5.28e-5	SMART
EGF_CA	182	219	6.14e-15	SMART
EGF	224	258	5.08e-7	SMART
EGF_CA	260	296	1.95e-8	SMART
EGF_CA	298	336	3.91e-8	SMART
EGF_CA	338	374	7.69e-7	SMART
EGF	378	413	6.86e-4	SMART
EGF_CA	415	454	4.15e-12	SMART
EGF_CA	456	492	3.24e-14	SMART
EGF_CA	494	530	4.77e-12	SMART
EGF_CA	532	568	2.04e-11	SMART
EGF_CA	570	605	1.18e-7	SMART
EGF_CA	607	643	7.12e-11	SMART
EGF_CA	645	680	1.82e-8	SMART
EGF_CA	682	718	1.42e-10	SMART
EGF_CA	720	755	1.25e-6	SMART
EGF_CA	757	793	3.61e-12	SMART
EGF_CA	795	831	1.53e-10	SMART
EGF	836	871	1.34e-6	SMART
EGF_CA	873	909	6.05e-14	SMART
EGF_CA	911	947	9.54e-12	SMART
EGF_CA	949	985	1.39e-13	SMART
EGF_CA	987	1023	1.26e-11	SMART
EGF_CA	1025	1061	9.31e-15	SMART
EGF	1066	1099	1.39e-4	SMART
EGF	1104	1147	2.6e-4	SMART
EGF_CA	1149	1185	1.55e-11	SMART
EGF_CA	1187	1223	2.74e-12	SMART
EGF_CA	1225	1262	4.15e-12	SMART
EGF	1267	1302	1.43e-1	SMART
EGF	1307	1343	2.33e-6	SMART
EGF	1377	1412	9.85e-5	SMART
NL	1418	1456	8.55e-19	SMART
NL	1459	1497	2.27e-14	SMART
NL	1498	1535	1.16e-11	SMART
NOD	1539	1595	3.4e-28	SMART
NODP	1619	1679	1.66e-22	SMART
transmembrane domain	1680	1702	N/A	INTRINSIC
ANK	1828	1872	2.18e2	SMART
ANK	1877	1906	3.36e-2	SMART
ANK	1910	1940	1.81e2	SMART
ANK	1944	1973	6.61e-1	SMART
ANK	1977	2006	5.24e-4	SMART
ANK	2010	2039	3.41e-3	SMART
low complexity region	2179	2193	N/A	INTRINSIC
low complexity region	2232	2241	N/A	INTRINSIC
DUF3454	2382	2447	4.62e-30	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.4%

Validation Efficiency

98% (91/93)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Notch family. Members of this Type 1 transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple, different domain types. Notch family members play a role in a variety of developmental processes by controlling cell fate decisions. The Notch signaling network is an evolutionarily conserved intercellular signaling pathway which regulates interactions between physically adjacent cells. In Drosophilia, notch interaction with its cell-bound ligands (delta, serrate) establishes an intercellular signaling pathway that plays a key role in development. Homologues of the notch-ligands have also been identified in human, but precise interactions between these ligands and the human notch homologues remain to be determined. This protein is cleaved in the trans-Golgi network, and presented on the cell surface as a heterodimer. This protein functions as a receptor for membrane bound ligands, and may play a role in vascular, renal and hepatic development. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygotes for null alleles exhibit defects in embryonic development resulting in embryonic or neonatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430A15Rik	A	T	2: 111,229,222	M64K	possibly damaging	Het
Abcc5	T	C	16: 20,333,729	T1356A	possibly damaging	Het
Ace3	A	G	11: 105,995,875	T154A	probably benign	Het
Arhgap31	C	A	16: 38,602,604	Q1033H	probably damaging	Het
BC067074	A	G	13: 113,351,629	R9G		Het
C1qtnf1	C	T	11: 118,446,514	R57*	probably null	Het
Cacna1g	T	C	11: 94,429,136	T1405A	probably damaging	Het
Cacna1i	A	G	15: 80,375,810		probably benign	Het
Cdca4	T	A	12: 112,822,114		probably null	Het
Cpa4	T	A	6: 30,585,159	M314K	probably damaging	Het
Cpn2	A	T	16: 30,259,267	S539T	possibly damaging	Het
Crebbp	A	G	16: 4,084,458	S2306P	probably damaging	Het
Dcaf5	T	C	12: 80,339,033	H773R	probably benign	Het
Dcun1d2	A	T	8: 13,261,406	D194E	probably benign	Het
Dnah1	G	T	14: 31,267,810	R3250S	possibly damaging	Het
Dnajc25	A	C	4: 59,020,195	K206T	possibly damaging	Het
Dnajc27	T	C	12: 4,096,325	L118P	possibly damaging	Het
Etl4	C	T	2: 20,709,477	T129I	probably damaging	Het
Faap100	A	G	11: 120,372,177	I785T	probably damaging	Het
Fam227b	A	T	2: 125,989,008	D425E	probably benign	Het
Fat4	C	G	3: 39,010,693	L4933V	probably damaging	Het
Fbrsl1	A	G	5: 110,378,220	F39L	probably damaging	Het
Fezf1	A	G	6: 23,247,770	V102A	probably benign	Het
Gabra2	T	C	5: 71,012,697		probably benign	Het
Garnl3	C	A	2: 33,026,094	R346L	probably damaging	Het
Grin2a	A	T	16: 9,585,225	I799N	possibly damaging	Het
Hspa4	A	G	11: 53,269,864	F462L	probably damaging	Het
Iars	C	A	13: 49,703,199		probably benign	Het
Igkv6-32	C	T	6: 70,074,079	V98M	possibly damaging	Het
Il31ra	A	G	13: 112,525,838	F560S	possibly damaging	Het
Itpr3	G	A	17: 27,118,677		probably benign	Het
Kif2a	G	A	13: 106,979,541	T299I	probably damaging	Het
Leo1	T	A	9: 75,466,262	Y656*	probably null	Het
Lpcat2	T	A	8: 92,909,236	V422D	probably damaging	Het
Lrrcc1	T	A	3: 14,536,024	S39T	probably benign	Het
Macf1	A	T	4: 123,512,076	S341T	probably benign	Het
Mc2r	T	A	18: 68,407,808	Y138F	probably damaging	Het
Mepe	A	G	5: 104,337,888	N298S	possibly damaging	Het
Mmp15	C	A	8: 95,366,354	N120K	possibly damaging	Het
Mrps9	A	G	1: 42,879,755	R106G	probably damaging	Het
Muc16	T	A	9: 18,646,448	M2850L	unknown	Het
Mxra8	T	A	4: 155,842,665	I352N	probably damaging	Het
Myo16	G	A	8: 10,361,042	V167I	unknown	Het
Neb	T	C	2: 52,325,039	D209G	probably damaging	Het
Nlgn2	A	G	11: 69,825,483	V744A	probably benign	Het
Nr1d1	G	C	11: 98,769,247	R484G	probably damaging	Het
Olfr180	G	A	16: 58,916,480	R54C	probably benign	Het
Olfr296-ps1	A	T	7: 86,561,939	H69L	unknown	Het
Olfr826	T	C	10: 130,180,833	I16V	probably benign	Het
Olfr988	T	C	2: 85,353,609	T106A	probably benign	Het
Oxa1l	A	G	14: 54,367,791		probably null	Het
Piwil4	T	C	9: 14,705,026	D15G		Het
Plcz1	C	A	6: 140,003,886	W461L	probably damaging	Het
Plek	A	T	11: 16,994,676	I118N	probably damaging	Het
Poc1b	C	A	10: 99,164,866		probably benign	Het
Ppp1r16b	G	A	2: 158,751,178	D226N	probably damaging	Het
Prss36	T	C	7: 127,933,463	T739A	possibly damaging	Het
Psme2	A	T	14: 55,589,617		probably null	Het
Ptprb	T	G	10: 116,367,590	V1802G	probably damaging	Het
Rabep2	C	A	7: 126,435,676	Y84*	probably null	Het
Rbbp6	T	G	7: 123,001,293	S1508A	unknown	Het
Rel	A	T	11: 23,742,430	D534E	probably benign	Het
Rpgrip1	G	A	14: 52,159,395	S1258N	probably damaging	Het
Rprml	T	C	11: 103,650,127	L116P	probably damaging	Het
Rsph10b	A	G	5: 143,950,294	T323A	possibly damaging	Het
Rtn4rl1	A	G	11: 75,265,273	H177R	probably damaging	Het
Sag	A	G	1: 87,810,310	T24A	probably benign	Het
Scgb2b26	G	T	7: 33,944,359	T52N	probably damaging	Het
Scn10a	T	C	9: 119,672,128	I197V	probably damaging	Het
Sec24c	T	A	14: 20,692,859	V1003D	possibly damaging	Het
Sirt2	G	A	7: 28,771,836	G30E	probably damaging	Het
Slc13a5	T	A	11: 72,259,093	Q197L	probably benign	Het
Slc44a3	A	T	3: 121,490,269	S445T	probably damaging	Het
Slc7a7	A	T	14: 54,372,992	V399E	probably benign	Het
Smarcad1	T	A	6: 65,111,881	D1000E	probably benign	Het
Sorcs2	G	T	5: 36,039,313	Q663K	probably benign	Het
Stat4	A	G	1: 52,079,832	R345G	probably null	Het
Sycp2	G	A	2: 178,350,975	R1261C	probably damaging	Het
Tcf19	T	C	17: 35,514,484	I259V	probably benign	Het
Thada	T	A	17: 84,229,209	R1636S	probably benign	Het
Tnrc6c	T	C	11: 117,714,135	L32P	probably benign	Het
Tonsl	G	A	15: 76,632,876	T881I	probably benign	Het
Tonsl	A	C	15: 76,634,063	C570G	probably damaging	Het
Ube2o	C	A	11: 116,541,447	E898*	probably null	Het
Usp5	T	C	6: 124,817,431	H762R	possibly damaging	Het
Vmn2r15	A	G	5: 109,286,913	S642P	probably benign	Het
Vmn2r23	T	C	6: 123,713,472	W436R	probably damaging	Het
Vps13d	A	C	4: 145,085,407	I3343M		Het
Wbp11	T	C	6: 136,822,934	K83E	probably damaging	Het
Zfp26	T	A	9: 20,444,905	N36Y	possibly damaging	Het
Zfp57	T	A	17: 37,010,046	I264N	probably damaging	Het

Other mutations in Notch2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00675:Notch2	APN	3	98111675	missense	possibly damaging	0.77
IGL01517:Notch2	APN	3	98138655	missense	probably benign	0.16
IGL01630:Notch2	APN	3	98146618	missense	possibly damaging	0.77
IGL01637:Notch2	APN	3	98146060	missense	probably damaging	1.00
IGL01828:Notch2	APN	3	98072613	missense	probably damaging	1.00
IGL01998:Notch2	APN	3	98143106	missense	probably damaging	1.00
IGL02008:Notch2	APN	3	98147296	missense	probably damaging	1.00
IGL02030:Notch2	APN	3	98099421	splice site	probably null
IGL02155:Notch2	APN	3	98138490	missense	probably damaging	0.98
IGL02268:Notch2	APN	3	98137397	missense	probably damaging	1.00
IGL02301:Notch2	APN	3	98141554	missense	probably benign	0.08
IGL02336:Notch2	APN	3	98138395	missense	possibly damaging	0.73
IGL02340:Notch2	APN	3	98147336	nonsense	probably null
IGL02536:Notch2	APN	3	98102407	missense	probably benign	0.03
IGL02589:Notch2	APN	3	98104347	critical splice acceptor site	probably null
IGL02633:Notch2	APN	3	98116697	splice site	probably benign
IGL02691:Notch2	APN	3	98135607	nonsense	probably null
IGL02832:Notch2	APN	3	98137373	missense	probably benign	0.12
IGL02894:Notch2	APN	3	98102432	nonsense	probably null
IGL02902:Notch2	APN	3	98111574	missense	probably damaging	1.00
IGL02967:Notch2	APN	3	98146144	missense	probably damaging	0.99
IGL03015:Notch2	APN	3	98072649	missense	possibly damaging	0.83
PIT4378001:Notch2	UTSW	3	98142956	missense	probably damaging	1.00
PIT4519001:Notch2	UTSW	3	98098108	missense	probably damaging	1.00
PIT4581001:Notch2	UTSW	3	98104462	missense	probably damaging	1.00
R0111:Notch2	UTSW	3	98138761	missense	probably benign	0.00
R0129:Notch2	UTSW	3	98146620	missense	probably benign	0.08
R0143:Notch2	UTSW	3	98146117	missense	probably damaging	0.99
R0480:Notch2	UTSW	3	98146537	missense	possibly damaging	0.88
R0523:Notch2	UTSW	3	98070970	missense	probably benign	0.34
R0523:Notch2	UTSW	3	98111598	missense	probably benign	0.00
R0531:Notch2	UTSW	3	98102451	splice site	probably benign
R0537:Notch2	UTSW	3	98116741	missense	possibly damaging	0.70
R0987:Notch2	UTSW	3	98134677	splice site	probably null
R1485:Notch2	UTSW	3	98100257	missense	probably benign	0.00
R1555:Notch2	UTSW	3	98131340	missense	possibly damaging	0.93
R1625:Notch2	UTSW	3	98111575	missense	probably damaging	1.00
R1699:Notch2	UTSW	3	98145127	missense	probably damaging	1.00
R1765:Notch2	UTSW	3	98121926	missense	probably damaging	1.00
R1794:Notch2	UTSW	3	98099547	missense	possibly damaging	0.53
R1974:Notch2	UTSW	3	98072755	missense	probably damaging	1.00
R2086:Notch2	UTSW	3	98102367	missense	probably damaging	1.00
R2099:Notch2	UTSW	3	98115321	missense	possibly damaging	0.79
R3778:Notch2	UTSW	3	98146623	missense	probably damaging	1.00
R3924:Notch2	UTSW	3	98122034	nonsense	probably null
R4018:Notch2	UTSW	3	98104565	missense	probably damaging	1.00
R4151:Notch2	UTSW	3	98147071	missense	possibly damaging	0.95
R4417:Notch2	UTSW	3	98131270	missense	possibly damaging	0.95
R4510:Notch2	UTSW	3	98146321	missense	probably benign	0.02
R4511:Notch2	UTSW	3	98146321	missense	probably benign	0.02
R4636:Notch2	UTSW	3	98146104	missense	probably benign	0.02
R4661:Notch2	UTSW	3	98135513	missense	probably damaging	1.00
R4856:Notch2	UTSW	3	98102419	missense	probably damaging	1.00
R4886:Notch2	UTSW	3	98102419	missense	probably damaging	1.00
R4945:Notch2	UTSW	3	98111721	missense	probably benign	0.01
R4970:Notch2	UTSW	3	98101636	critical splice donor site	probably null
R4974:Notch2	UTSW	3	98139633	missense	probably benign	0.39
R5082:Notch2	UTSW	3	98100374	missense	probably damaging	1.00
R5112:Notch2	UTSW	3	98101636	critical splice donor site	probably null
R5156:Notch2	UTSW	3	98124310	missense	possibly damaging	0.53
R5433:Notch2	UTSW	3	98126134	missense	probably damaging	1.00
R5539:Notch2	UTSW	3	98137582	missense	probably damaging	0.99
R5813:Notch2	UTSW	3	98135428	missense	probably benign
R5827:Notch2	UTSW	3	98072862	missense	possibly damaging	0.64
R5908:Notch2	UTSW	3	98123923	intron	probably benign
R6021:Notch2	UTSW	3	98121972	missense	probably damaging	1.00
R6090:Notch2	UTSW	3	98135377	nonsense	probably null
R6103:Notch2	UTSW	3	98135743	missense	possibly damaging	0.94
R6111:Notch2	UTSW	3	98146293	missense	probably benign	0.00
R6168:Notch2	UTSW	3	98145217	missense	probably damaging	1.00
R6382:Notch2	UTSW	3	98141543	missense	probably damaging	1.00
R6404:Notch2	UTSW	3	98081998	missense	probably damaging	1.00
R6419:Notch2	UTSW	3	98100389	critical splice donor site	probably null
R6454:Notch2	UTSW	3	98137406	missense	possibly damaging	0.47
R6626:Notch2	UTSW	3	98101605	missense	probably damaging	1.00
R6629:Notch2	UTSW	3	98120881	missense	possibly damaging	0.65
R6706:Notch2	UTSW	3	98138430	missense	possibly damaging	0.94
R6735:Notch2	UTSW	3	98134586	missense	probably damaging	1.00
R6837:Notch2	UTSW	3	98070854	splice site	probably null
R7021:Notch2	UTSW	3	98135446	missense	probably benign
R7028:Notch2	UTSW	3	98102387	missense	probably damaging	1.00
R7228:Notch2	UTSW	3	98137317	nonsense	probably null
R7320:Notch2	UTSW	3	98131327	missense	possibly damaging	0.94
R7361:Notch2	UTSW	3	98131402	missense	probably benign	0.04
R7562:Notch2	UTSW	3	98113114	missense	probably damaging	1.00
R7630:Notch2	UTSW	3	98137508	missense	possibly damaging	0.65
R7637:Notch2	UTSW	3	98146623	missense	probably damaging	1.00
R7748:Notch2	UTSW	3	98138484	missense	possibly damaging	0.69
R7764:Notch2	UTSW	3	98142988	missense	probably damaging	1.00
R7817:Notch2	UTSW	3	98107127	missense	probably damaging	1.00
R7952:Notch2	UTSW	3	98100236	missense	probably benign	0.30
R8136:Notch2	UTSW	3	98124221	missense	probably damaging	1.00
R8159:Notch2	UTSW	3	98120922	missense	possibly damaging	0.95
R8879:Notch2	UTSW	3	98135599	missense	possibly damaging	0.73
R9146:Notch2	UTSW	3	98104538	missense	probably damaging	1.00
R9398:Notch2	UTSW	3	98102352	missense	probably damaging	1.00
R9422:Notch2	UTSW	3	98147352	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTGTTTGTCCAGTTAAATCCTC -3'
(R):5'- ACAGATGCATCGGTAGGTACC -3'

Sequencing Primer
(F):5'- CATTACAGATGGTTGTGAGCCACC -3'
(R):5'- ATGCATCGGTAGGTACCCAGAC -3'

Posted On

2021-03-08