Incidental Mutation 'R8679:Sorcs2'
ID 661574
Institutional Source Beutler Lab
Gene Symbol Sorcs2
Ensembl Gene ENSMUSG00000029093
Gene Name sortilin-related VPS10 domain containing receptor 2
Synonyms VPS10 domain receptor protein
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8679 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 36017180-36398139 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 36039313 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 663 (Q663K)
Ref Sequence ENSEMBL: ENSMUSP00000041828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037370]
AlphaFold Q9EPR5
Predicted Effect probably benign
Transcript: ENSMUST00000037370
AA Change: Q663K

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000041828
Gene: ENSMUSG00000029093
AA Change: Q663K

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 89 103 N/A INTRINSIC
low complexity region 106 130 N/A INTRINSIC
VPS10 170 780 N/A SMART
PKD 782 872 7.27e-2 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency 98% (91/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to reduced dopamine levels and dopamine metabolism, dopaminergic hyperinnervation of the frontal cortex, hyperactivity, abnormal behavioral response to amphetamine, and decreased induction of Schwann cell apoptosis following sciatic nerve injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A T 2: 111,229,222 M64K possibly damaging Het
Abcc5 T C 16: 20,333,729 T1356A possibly damaging Het
Ace3 A G 11: 105,995,875 T154A probably benign Het
Arhgap31 C A 16: 38,602,604 Q1033H probably damaging Het
BC067074 A G 13: 113,351,629 R9G Het
C1qtnf1 C T 11: 118,446,514 R57* probably null Het
Cacna1g T C 11: 94,429,136 T1405A probably damaging Het
Cacna1i A G 15: 80,375,810 probably benign Het
Cdca4 T A 12: 112,822,114 probably null Het
Cpa4 T A 6: 30,585,159 M314K probably damaging Het
Cpn2 A T 16: 30,259,267 S539T possibly damaging Het
Crebbp A G 16: 4,084,458 S2306P probably damaging Het
Dcaf5 T C 12: 80,339,033 H773R probably benign Het
Dcun1d2 A T 8: 13,261,406 D194E probably benign Het
Dnah1 G T 14: 31,267,810 R3250S possibly damaging Het
Dnajc25 A C 4: 59,020,195 K206T possibly damaging Het
Dnajc27 T C 12: 4,096,325 L118P possibly damaging Het
Etl4 C T 2: 20,709,477 T129I probably damaging Het
Faap100 A G 11: 120,372,177 I785T probably damaging Het
Fam227b A T 2: 125,989,008 D425E probably benign Het
Fat4 C G 3: 39,010,693 L4933V probably damaging Het
Fbrsl1 A G 5: 110,378,220 F39L probably damaging Het
Fezf1 A G 6: 23,247,770 V102A probably benign Het
Gabra2 T C 5: 71,012,697 probably benign Het
Garnl3 C A 2: 33,026,094 R346L probably damaging Het
Grin2a A T 16: 9,585,225 I799N possibly damaging Het
Hspa4 A G 11: 53,269,864 F462L probably damaging Het
Iars C A 13: 49,703,199 probably benign Het
Igkv6-32 C T 6: 70,074,079 V98M possibly damaging Het
Il31ra A G 13: 112,525,838 F560S possibly damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kif2a G A 13: 106,979,541 T299I probably damaging Het
Leo1 T A 9: 75,466,262 Y656* probably null Het
Lpcat2 T A 8: 92,909,236 V422D probably damaging Het
Lrrcc1 T A 3: 14,536,024 S39T probably benign Het
Macf1 A T 4: 123,512,076 S341T probably benign Het
Mc2r T A 18: 68,407,808 Y138F probably damaging Het
Mepe A G 5: 104,337,888 N298S possibly damaging Het
Mmp15 C A 8: 95,366,354 N120K possibly damaging Het
Mrps9 A G 1: 42,879,755 R106G probably damaging Het
Muc16 T A 9: 18,646,448 M2850L unknown Het
Mxra8 T A 4: 155,842,665 I352N probably damaging Het
Myo16 G A 8: 10,361,042 V167I unknown Het
Neb T C 2: 52,325,039 D209G probably damaging Het
Nlgn2 A G 11: 69,825,483 V744A probably benign Het
Notch2 A G 3: 98,121,902 probably null Het
Nr1d1 G C 11: 98,769,247 R484G probably damaging Het
Olfr180 G A 16: 58,916,480 R54C probably benign Het
Olfr296-ps1 A T 7: 86,561,939 H69L unknown Het
Olfr826 T C 10: 130,180,833 I16V probably benign Het
Olfr988 T C 2: 85,353,609 T106A probably benign Het
Oxa1l A G 14: 54,367,791 probably null Het
Piwil4 T C 9: 14,705,026 D15G Het
Plcz1 C A 6: 140,003,886 W461L probably damaging Het
Plek A T 11: 16,994,676 I118N probably damaging Het
Poc1b C A 10: 99,164,866 probably benign Het
Ppp1r16b G A 2: 158,751,178 D226N probably damaging Het
Prss36 T C 7: 127,933,463 T739A possibly damaging Het
Psme2 A T 14: 55,589,617 probably null Het
Ptprb T G 10: 116,367,590 V1802G probably damaging Het
Rabep2 C A 7: 126,435,676 Y84* probably null Het
Rbbp6 T G 7: 123,001,293 S1508A unknown Het
Rel A T 11: 23,742,430 D534E probably benign Het
Rpgrip1 G A 14: 52,159,395 S1258N probably damaging Het
Rprml T C 11: 103,650,127 L116P probably damaging Het
Rsph10b A G 5: 143,950,294 T323A possibly damaging Het
Rtn4rl1 A G 11: 75,265,273 H177R probably damaging Het
Sag A G 1: 87,810,310 T24A probably benign Het
Scgb2b26 G T 7: 33,944,359 T52N probably damaging Het
Scn10a T C 9: 119,672,128 I197V probably damaging Het
Sec24c T A 14: 20,692,859 V1003D possibly damaging Het
Sirt2 G A 7: 28,771,836 G30E probably damaging Het
Slc13a5 T A 11: 72,259,093 Q197L probably benign Het
Slc44a3 A T 3: 121,490,269 S445T probably damaging Het
Slc7a7 A T 14: 54,372,992 V399E probably benign Het
Smarcad1 T A 6: 65,111,881 D1000E probably benign Het
Stat4 A G 1: 52,079,832 R345G probably null Het
Sycp2 G A 2: 178,350,975 R1261C probably damaging Het
Tcf19 T C 17: 35,514,484 I259V probably benign Het
Thada T A 17: 84,229,209 R1636S probably benign Het
Tnrc6c T C 11: 117,714,135 L32P probably benign Het
Tonsl G A 15: 76,632,876 T881I probably benign Het
Tonsl A C 15: 76,634,063 C570G probably damaging Het
Ube2o C A 11: 116,541,447 E898* probably null Het
Usp5 T C 6: 124,817,431 H762R possibly damaging Het
Vmn2r15 A G 5: 109,286,913 S642P probably benign Het
Vmn2r23 T C 6: 123,713,472 W436R probably damaging Het
Vps13d A C 4: 145,085,407 I3343M Het
Wbp11 T C 6: 136,822,934 K83E probably damaging Het
Zfp26 T A 9: 20,444,905 N36Y possibly damaging Het
Zfp57 T A 17: 37,010,046 I264N probably damaging Het
Other mutations in Sorcs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Sorcs2 APN 5 36037401 splice site probably null
IGL01064:Sorcs2 APN 5 36065352 missense probably damaging 1.00
IGL01120:Sorcs2 APN 5 36021252 missense probably damaging 0.99
IGL01730:Sorcs2 APN 5 36047809 missense probably damaging 1.00
IGL02542:Sorcs2 APN 5 36025942 missense probably damaging 0.98
IGL02730:Sorcs2 APN 5 36062552 missense probably benign 0.11
IGL02965:Sorcs2 APN 5 36077957 missense probably benign 0.13
IGL02997:Sorcs2 APN 5 36068148 missense probably damaging 1.00
IGL03000:Sorcs2 APN 5 36065331 unclassified probably benign
IGL03141:Sorcs2 APN 5 36065355 missense probably benign 0.01
IGL03184:Sorcs2 APN 5 36031212 missense probably benign 0.01
IGL03412:Sorcs2 APN 5 36046504 missense probably damaging 1.00
R0180:Sorcs2 UTSW 5 36153845 missense probably damaging 1.00
R0244:Sorcs2 UTSW 5 36397553 splice site probably benign
R0345:Sorcs2 UTSW 5 36027874 missense probably benign 0.01
R0519:Sorcs2 UTSW 5 36031190 missense probably benign 0.08
R0624:Sorcs2 UTSW 5 36065433 missense probably damaging 0.97
R0625:Sorcs2 UTSW 5 36024572 missense possibly damaging 0.65
R1169:Sorcs2 UTSW 5 36027925 missense possibly damaging 0.70
R1721:Sorcs2 UTSW 5 36026748 missense probably damaging 0.98
R1809:Sorcs2 UTSW 5 36229220 splice site probably benign
R1935:Sorcs2 UTSW 5 36071387 missense possibly damaging 0.88
R1936:Sorcs2 UTSW 5 36071387 missense possibly damaging 0.88
R2279:Sorcs2 UTSW 5 36042086 splice site probably null
R3148:Sorcs2 UTSW 5 36035788 missense probably benign 0.09
R3803:Sorcs2 UTSW 5 36397806 missense probably benign 0.36
R3863:Sorcs2 UTSW 5 36397663 nonsense probably null
R4092:Sorcs2 UTSW 5 36025822 missense possibly damaging 0.92
R4620:Sorcs2 UTSW 5 36037494 missense probably benign 0.00
R5079:Sorcs2 UTSW 5 36043452 missense probably damaging 1.00
R5301:Sorcs2 UTSW 5 36039390 missense probably damaging 1.00
R5470:Sorcs2 UTSW 5 36031183 missense probably benign 0.00
R5568:Sorcs2 UTSW 5 36046530 nonsense probably null
R5727:Sorcs2 UTSW 5 36031286 missense possibly damaging 0.52
R5874:Sorcs2 UTSW 5 36229211 missense probably damaging 1.00
R5890:Sorcs2 UTSW 5 36229191 missense probably damaging 1.00
R5946:Sorcs2 UTSW 5 36029083 missense probably damaging 1.00
R6005:Sorcs2 UTSW 5 36019384 missense probably damaging 1.00
R6048:Sorcs2 UTSW 5 36027988 splice site probably null
R6290:Sorcs2 UTSW 5 36062587 missense probably damaging 1.00
R6292:Sorcs2 UTSW 5 36062587 missense probably damaging 1.00
R6617:Sorcs2 UTSW 5 36077966 missense probably damaging 1.00
R6681:Sorcs2 UTSW 5 36397810 missense probably benign 0.00
R7024:Sorcs2 UTSW 5 36021261 missense probably damaging 0.99
R7056:Sorcs2 UTSW 5 36068130 missense probably damaging 1.00
R7569:Sorcs2 UTSW 5 36025876 missense probably benign 0.01
R7641:Sorcs2 UTSW 5 36397952 missense probably damaging 0.99
R7651:Sorcs2 UTSW 5 36027978 missense probably damaging 1.00
R7674:Sorcs2 UTSW 5 36397952 missense probably damaging 0.99
R7722:Sorcs2 UTSW 5 36043527 missense probably damaging 1.00
R7748:Sorcs2 UTSW 5 36229175 missense possibly damaging 0.56
R7764:Sorcs2 UTSW 5 36024072 missense possibly damaging 0.48
R7813:Sorcs2 UTSW 5 36024614 missense probably damaging 1.00
R8142:Sorcs2 UTSW 5 36062614 missense possibly damaging 0.67
R8246:Sorcs2 UTSW 5 36062588 missense probably damaging 1.00
R8254:Sorcs2 UTSW 5 36038206 missense probably benign 0.00
R8349:Sorcs2 UTSW 5 36229175 missense possibly damaging 0.56
R8350:Sorcs2 UTSW 5 36153863 missense probably damaging 0.96
R8354:Sorcs2 UTSW 5 36065409 missense probably benign 0.01
R8449:Sorcs2 UTSW 5 36229175 missense possibly damaging 0.56
R8771:Sorcs2 UTSW 5 36031280 missense probably damaging 1.00
R8935:Sorcs2 UTSW 5 36035858 missense possibly damaging 0.79
R8964:Sorcs2 UTSW 5 36229167 missense possibly damaging 0.85
R9164:Sorcs2 UTSW 5 36077968 missense possibly damaging 0.94
R9221:Sorcs2 UTSW 5 36024566 critical splice donor site probably null
R9290:Sorcs2 UTSW 5 36025881 missense probably damaging 0.96
R9358:Sorcs2 UTSW 5 36043470 missense probably damaging 1.00
RF063:Sorcs2 UTSW 5 36153811 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCAAGGTGCGAAGGTTAGAC -3'
(R):5'- TGTCTGGTCATCAGGGAAGG -3'

Sequencing Primer
(F):5'- GCCTCAGACCCTGATGTCATATAG -3'
(R):5'- GAAGGGTCCATCTGAAGTGTC -3'
Posted On 2021-03-08