Mutagenetix > Incidental Mutations

Incidental Mutation 'R8679:Sorcs2'

661574

Institutional Source

Beutler Lab

Gene Symbol

Sorcs2

Ensembl Gene

ENSMUSG00000029093

Gene Name

sortilin-related VPS10 domain containing receptor 2

Synonyms

VPS10 domain receptor protein

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8679 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

36017180-36398139 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 36039313 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 663 (Q663K)

Ref Sequence

ENSEMBL: ENSMUSP00000041828 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037370]

AlphaFold

Q9EPR5

Predicted Effect

probably benign
Transcript: ENSMUST00000037370
AA Change: Q663K

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000041828
Gene: ENSMUSG00000029093
AA Change: Q663K

Domain	Start	End	E-Value	Type
signal peptide	1	51	N/A	INTRINSIC
low complexity region	54	64	N/A	INTRINSIC
low complexity region	89	103	N/A	INTRINSIC
low complexity region	106	130	N/A	INTRINSIC
VPS10	170	780	N/A	SMART
PKD	782	872	7.27e-2	SMART
transmembrane domain	1078	1100	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.4%

Validation Efficiency

98% (91/93)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to reduced dopamine levels and dopamine metabolism, dopaminergic hyperinnervation of the frontal cortex, hyperactivity, abnormal behavioral response to amphetamine, and decreased induction of Schwann cell apoptosis following sciatic nerve injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430A15Rik	A	T	2: 111,229,222	M64K	possibly damaging	Het
Abcc5	T	C	16: 20,333,729	T1356A	possibly damaging	Het
Ace3	A	G	11: 105,995,875	T154A	probably benign	Het
Arhgap31	C	A	16: 38,602,604	Q1033H	probably damaging	Het
BC067074	A	G	13: 113,351,629	R9G		Het
C1qtnf1	C	T	11: 118,446,514	R57*	probably null	Het
Cacna1g	T	C	11: 94,429,136	T1405A	probably damaging	Het
Cacna1i	A	G	15: 80,375,810		probably benign	Het
Cdca4	T	A	12: 112,822,114		probably null	Het
Cpa4	T	A	6: 30,585,159	M314K	probably damaging	Het
Cpn2	A	T	16: 30,259,267	S539T	possibly damaging	Het
Crebbp	A	G	16: 4,084,458	S2306P	probably damaging	Het
Dcaf5	T	C	12: 80,339,033	H773R	probably benign	Het
Dcun1d2	A	T	8: 13,261,406	D194E	probably benign	Het
Dnah1	G	T	14: 31,267,810	R3250S	possibly damaging	Het
Dnajc25	A	C	4: 59,020,195	K206T	possibly damaging	Het
Dnajc27	T	C	12: 4,096,325	L118P	possibly damaging	Het
Etl4	C	T	2: 20,709,477	T129I	probably damaging	Het
Faap100	A	G	11: 120,372,177	I785T	probably damaging	Het
Fam227b	A	T	2: 125,989,008	D425E	probably benign	Het
Fat4	C	G	3: 39,010,693	L4933V	probably damaging	Het
Fbrsl1	A	G	5: 110,378,220	F39L	probably damaging	Het
Fezf1	A	G	6: 23,247,770	V102A	probably benign	Het
Gabra2	T	C	5: 71,012,697		probably benign	Het
Garnl3	C	A	2: 33,026,094	R346L	probably damaging	Het
Grin2a	A	T	16: 9,585,225	I799N	possibly damaging	Het
Hspa4	A	G	11: 53,269,864	F462L	probably damaging	Het
Iars	C	A	13: 49,703,199		probably benign	Het
Igkv6-32	C	T	6: 70,074,079	V98M	possibly damaging	Het
Il31ra	A	G	13: 112,525,838	F560S	possibly damaging	Het
Itpr3	G	A	17: 27,118,677		probably benign	Het
Kif2a	G	A	13: 106,979,541	T299I	probably damaging	Het
Leo1	T	A	9: 75,466,262	Y656*	probably null	Het
Lpcat2	T	A	8: 92,909,236	V422D	probably damaging	Het
Lrrcc1	T	A	3: 14,536,024	S39T	probably benign	Het
Macf1	A	T	4: 123,512,076	S341T	probably benign	Het
Mc2r	T	A	18: 68,407,808	Y138F	probably damaging	Het
Mepe	A	G	5: 104,337,888	N298S	possibly damaging	Het
Mmp15	C	A	8: 95,366,354	N120K	possibly damaging	Het
Mrps9	A	G	1: 42,879,755	R106G	probably damaging	Het
Muc16	T	A	9: 18,646,448	M2850L	unknown	Het
Mxra8	T	A	4: 155,842,665	I352N	probably damaging	Het
Myo16	G	A	8: 10,361,042	V167I	unknown	Het
Neb	T	C	2: 52,325,039	D209G	probably damaging	Het
Nlgn2	A	G	11: 69,825,483	V744A	probably benign	Het
Notch2	A	G	3: 98,121,902		probably null	Het
Nr1d1	G	C	11: 98,769,247	R484G	probably damaging	Het
Olfr180	G	A	16: 58,916,480	R54C	probably benign	Het
Olfr296-ps1	A	T	7: 86,561,939	H69L	unknown	Het
Olfr826	T	C	10: 130,180,833	I16V	probably benign	Het
Olfr988	T	C	2: 85,353,609	T106A	probably benign	Het
Oxa1l	A	G	14: 54,367,791		probably null	Het
Piwil4	T	C	9: 14,705,026	D15G		Het
Plcz1	C	A	6: 140,003,886	W461L	probably damaging	Het
Plek	A	T	11: 16,994,676	I118N	probably damaging	Het
Poc1b	C	A	10: 99,164,866		probably benign	Het
Ppp1r16b	G	A	2: 158,751,178	D226N	probably damaging	Het
Prss36	T	C	7: 127,933,463	T739A	possibly damaging	Het
Psme2	A	T	14: 55,589,617		probably null	Het
Ptprb	T	G	10: 116,367,590	V1802G	probably damaging	Het
Rabep2	C	A	7: 126,435,676	Y84*	probably null	Het
Rbbp6	T	G	7: 123,001,293	S1508A	unknown	Het
Rel	A	T	11: 23,742,430	D534E	probably benign	Het
Rpgrip1	G	A	14: 52,159,395	S1258N	probably damaging	Het
Rprml	T	C	11: 103,650,127	L116P	probably damaging	Het
Rsph10b	A	G	5: 143,950,294	T323A	possibly damaging	Het
Rtn4rl1	A	G	11: 75,265,273	H177R	probably damaging	Het
Sag	A	G	1: 87,810,310	T24A	probably benign	Het
Scgb2b26	G	T	7: 33,944,359	T52N	probably damaging	Het
Scn10a	T	C	9: 119,672,128	I197V	probably damaging	Het
Sec24c	T	A	14: 20,692,859	V1003D	possibly damaging	Het
Sirt2	G	A	7: 28,771,836	G30E	probably damaging	Het
Slc13a5	T	A	11: 72,259,093	Q197L	probably benign	Het
Slc44a3	A	T	3: 121,490,269	S445T	probably damaging	Het
Slc7a7	A	T	14: 54,372,992	V399E	probably benign	Het
Smarcad1	T	A	6: 65,111,881	D1000E	probably benign	Het
Stat4	A	G	1: 52,079,832	R345G	probably null	Het
Sycp2	G	A	2: 178,350,975	R1261C	probably damaging	Het
Tcf19	T	C	17: 35,514,484	I259V	probably benign	Het
Thada	T	A	17: 84,229,209	R1636S	probably benign	Het
Tnrc6c	T	C	11: 117,714,135	L32P	probably benign	Het
Tonsl	G	A	15: 76,632,876	T881I	probably benign	Het
Tonsl	A	C	15: 76,634,063	C570G	probably damaging	Het
Ube2o	C	A	11: 116,541,447	E898*	probably null	Het
Usp5	T	C	6: 124,817,431	H762R	possibly damaging	Het
Vmn2r15	A	G	5: 109,286,913	S642P	probably benign	Het
Vmn2r23	T	C	6: 123,713,472	W436R	probably damaging	Het
Vps13d	A	C	4: 145,085,407	I3343M		Het
Wbp11	T	C	6: 136,822,934	K83E	probably damaging	Het
Zfp26	T	A	9: 20,444,905	N36Y	possibly damaging	Het
Zfp57	T	A	17: 37,010,046	I264N	probably damaging	Het

Other mutations in Sorcs2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00401:Sorcs2	APN	5	36037401	splice site	probably null
IGL01064:Sorcs2	APN	5	36065352	missense	probably damaging	1.00
IGL01120:Sorcs2	APN	5	36021252	missense	probably damaging	0.99
IGL01730:Sorcs2	APN	5	36047809	missense	probably damaging	1.00
IGL02542:Sorcs2	APN	5	36025942	missense	probably damaging	0.98
IGL02730:Sorcs2	APN	5	36062552	missense	probably benign	0.11
IGL02965:Sorcs2	APN	5	36077957	missense	probably benign	0.13
IGL02997:Sorcs2	APN	5	36068148	missense	probably damaging	1.00
IGL03000:Sorcs2	APN	5	36065331	unclassified	probably benign
IGL03141:Sorcs2	APN	5	36065355	missense	probably benign	0.01
IGL03184:Sorcs2	APN	5	36031212	missense	probably benign	0.01
IGL03412:Sorcs2	APN	5	36046504	missense	probably damaging	1.00
R0180:Sorcs2	UTSW	5	36153845	missense	probably damaging	1.00
R0244:Sorcs2	UTSW	5	36397553	splice site	probably benign
R0345:Sorcs2	UTSW	5	36027874	missense	probably benign	0.01
R0519:Sorcs2	UTSW	5	36031190	missense	probably benign	0.08
R0624:Sorcs2	UTSW	5	36065433	missense	probably damaging	0.97
R0625:Sorcs2	UTSW	5	36024572	missense	possibly damaging	0.65
R1169:Sorcs2	UTSW	5	36027925	missense	possibly damaging	0.70
R1721:Sorcs2	UTSW	5	36026748	missense	probably damaging	0.98
R1809:Sorcs2	UTSW	5	36229220	splice site	probably benign
R1935:Sorcs2	UTSW	5	36071387	missense	possibly damaging	0.88
R1936:Sorcs2	UTSW	5	36071387	missense	possibly damaging	0.88
R2279:Sorcs2	UTSW	5	36042086	splice site	probably null
R3148:Sorcs2	UTSW	5	36035788	missense	probably benign	0.09
R3803:Sorcs2	UTSW	5	36397806	missense	probably benign	0.36
R3863:Sorcs2	UTSW	5	36397663	nonsense	probably null
R4092:Sorcs2	UTSW	5	36025822	missense	possibly damaging	0.92
R4620:Sorcs2	UTSW	5	36037494	missense	probably benign	0.00
R5079:Sorcs2	UTSW	5	36043452	missense	probably damaging	1.00
R5301:Sorcs2	UTSW	5	36039390	missense	probably damaging	1.00
R5470:Sorcs2	UTSW	5	36031183	missense	probably benign	0.00
R5568:Sorcs2	UTSW	5	36046530	nonsense	probably null
R5727:Sorcs2	UTSW	5	36031286	missense	possibly damaging	0.52
R5874:Sorcs2	UTSW	5	36229211	missense	probably damaging	1.00
R5890:Sorcs2	UTSW	5	36229191	missense	probably damaging	1.00
R5946:Sorcs2	UTSW	5	36029083	missense	probably damaging	1.00
R6005:Sorcs2	UTSW	5	36019384	missense	probably damaging	1.00
R6048:Sorcs2	UTSW	5	36027988	splice site	probably null
R6290:Sorcs2	UTSW	5	36062587	missense	probably damaging	1.00
R6292:Sorcs2	UTSW	5	36062587	missense	probably damaging	1.00
R6617:Sorcs2	UTSW	5	36077966	missense	probably damaging	1.00
R6681:Sorcs2	UTSW	5	36397810	missense	probably benign	0.00
R7024:Sorcs2	UTSW	5	36021261	missense	probably damaging	0.99
R7056:Sorcs2	UTSW	5	36068130	missense	probably damaging	1.00
R7569:Sorcs2	UTSW	5	36025876	missense	probably benign	0.01
R7641:Sorcs2	UTSW	5	36397952	missense	probably damaging	0.99
R7651:Sorcs2	UTSW	5	36027978	missense	probably damaging	1.00
R7674:Sorcs2	UTSW	5	36397952	missense	probably damaging	0.99
R7722:Sorcs2	UTSW	5	36043527	missense	probably damaging	1.00
R7748:Sorcs2	UTSW	5	36229175	missense	possibly damaging	0.56
R7764:Sorcs2	UTSW	5	36024072	missense	possibly damaging	0.48
R7813:Sorcs2	UTSW	5	36024614	missense	probably damaging	1.00
R8142:Sorcs2	UTSW	5	36062614	missense	possibly damaging	0.67
R8246:Sorcs2	UTSW	5	36062588	missense	probably damaging	1.00
R8254:Sorcs2	UTSW	5	36038206	missense	probably benign	0.00
R8349:Sorcs2	UTSW	5	36229175	missense	possibly damaging	0.56
R8350:Sorcs2	UTSW	5	36153863	missense	probably damaging	0.96
R8354:Sorcs2	UTSW	5	36065409	missense	probably benign	0.01
R8449:Sorcs2	UTSW	5	36229175	missense	possibly damaging	0.56
R8771:Sorcs2	UTSW	5	36031280	missense	probably damaging	1.00
R8935:Sorcs2	UTSW	5	36035858	missense	possibly damaging	0.79
R8964:Sorcs2	UTSW	5	36229167	missense	possibly damaging	0.85
R9164:Sorcs2	UTSW	5	36077968	missense	possibly damaging	0.94
R9221:Sorcs2	UTSW	5	36024566	critical splice donor site	probably null
R9290:Sorcs2	UTSW	5	36025881	missense	probably damaging	0.96
R9358:Sorcs2	UTSW	5	36043470	missense	probably damaging	1.00
RF063:Sorcs2	UTSW	5	36153811	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CCAAGGTGCGAAGGTTAGAC -3'
(R):5'- TGTCTGGTCATCAGGGAAGG -3'

Sequencing Primer
(F):5'- GCCTCAGACCCTGATGTCATATAG -3'
(R):5'- GAAGGGTCCATCTGAAGTGTC -3'

Posted On

2021-03-08