Mutagenetix > Incidental Mutation

Incidental Mutation 'R8679:Vmn2r23'

661583

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r23

Ensembl Gene

ENSMUSG00000091620

Gene Name

vomeronasal 2, receptor 23

Synonyms

EG435916

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.072) question?

Stock #

R8679 (G1)

Quality Score

108.008

Status

Validated

Chromosome

Chromosomal Location

123702821-123742291 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 123713472 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 436 (W436R)

Ref Sequence

ENSEMBL: ENSMUSP00000126682 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000172391]

AlphaFold

E9PXI5

Predicted Effect

probably damaging
Transcript: ENSMUST00000172391
AA Change: W436R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: W436R

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:ANF_receptor	79	461	1.7e-31	PFAM
Pfam:NCD3G	513	566	1.2e-23	PFAM
Pfam:7tm_3	596	834	1.5e-55	PFAM

Meta Mutation Damage Score

0.6329

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.4%

Validation Efficiency

98% (91/93)

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430A15Rik	A	T	2: 111,229,222	M64K	possibly damaging	Het
Abcc5	T	C	16: 20,333,729	T1356A	possibly damaging	Het
Ace3	A	G	11: 105,995,875	T154A	probably benign	Het
Arhgap31	C	A	16: 38,602,604	Q1033H	probably damaging	Het
BC067074	A	G	13: 113,351,629	R9G		Het
C1qtnf1	C	T	11: 118,446,514	R57*	probably null	Het
Cacna1g	T	C	11: 94,429,136	T1405A	probably damaging	Het
Cacna1i	A	G	15: 80,375,810		probably benign	Het
Cdca4	T	A	12: 112,822,114		probably null	Het
Cpa4	T	A	6: 30,585,159	M314K	probably damaging	Het
Cpn2	A	T	16: 30,259,267	S539T	possibly damaging	Het
Crebbp	A	G	16: 4,084,458	S2306P	probably damaging	Het
Dcaf5	T	C	12: 80,339,033	H773R	probably benign	Het
Dcun1d2	A	T	8: 13,261,406	D194E	probably benign	Het
Dnah1	G	T	14: 31,267,810	R3250S	possibly damaging	Het
Dnajc25	A	C	4: 59,020,195	K206T	possibly damaging	Het
Dnajc27	T	C	12: 4,096,325	L118P	possibly damaging	Het
Etl4	C	T	2: 20,709,477	T129I	probably damaging	Het
Faap100	A	G	11: 120,372,177	I785T	probably damaging	Het
Fam227b	A	T	2: 125,989,008	D425E	probably benign	Het
Fat4	C	G	3: 39,010,693	L4933V	probably damaging	Het
Fbrsl1	A	G	5: 110,378,220	F39L	probably damaging	Het
Fezf1	A	G	6: 23,247,770	V102A	probably benign	Het
Gabra2	T	C	5: 71,012,697		probably benign	Het
Garnl3	C	A	2: 33,026,094	R346L	probably damaging	Het
Grin2a	A	T	16: 9,585,225	I799N	possibly damaging	Het
Hspa4	A	G	11: 53,269,864	F462L	probably damaging	Het
Iars	C	A	13: 49,703,199		probably benign	Het
Igkv6-32	C	T	6: 70,074,079	V98M	possibly damaging	Het
Il31ra	A	G	13: 112,525,838	F560S	possibly damaging	Het
Itpr3	G	A	17: 27,118,677		probably benign	Het
Kif2a	G	A	13: 106,979,541	T299I	probably damaging	Het
Leo1	T	A	9: 75,466,262	Y656*	probably null	Het
Lpcat2	T	A	8: 92,909,236	V422D	probably damaging	Het
Lrrcc1	T	A	3: 14,536,024	S39T	probably benign	Het
Macf1	A	T	4: 123,512,076	S341T	probably benign	Het
Mc2r	T	A	18: 68,407,808	Y138F	probably damaging	Het
Mepe	A	G	5: 104,337,888	N298S	possibly damaging	Het
Mmp15	C	A	8: 95,366,354	N120K	possibly damaging	Het
Mrps9	A	G	1: 42,879,755	R106G	probably damaging	Het
Muc16	T	A	9: 18,646,448	M2850L	unknown	Het
Mxra8	T	A	4: 155,842,665	I352N	probably damaging	Het
Myo16	G	A	8: 10,361,042	V167I	unknown	Het
Neb	T	C	2: 52,325,039	D209G	probably damaging	Het
Nlgn2	A	G	11: 69,825,483	V744A	probably benign	Het
Notch2	A	G	3: 98,121,902		probably null	Het
Nr1d1	G	C	11: 98,769,247	R484G	probably damaging	Het
Olfr180	G	A	16: 58,916,480	R54C	probably benign	Het
Olfr296-ps1	A	T	7: 86,561,939	H69L	unknown	Het
Olfr826	T	C	10: 130,180,833	I16V	probably benign	Het
Olfr988	T	C	2: 85,353,609	T106A	probably benign	Het
Oxa1l	A	G	14: 54,367,791		probably null	Het
Piwil4	T	C	9: 14,705,026	D15G		Het
Plcz1	C	A	6: 140,003,886	W461L	probably damaging	Het
Plek	A	T	11: 16,994,676	I118N	probably damaging	Het
Poc1b	C	A	10: 99,164,866		probably benign	Het
Ppp1r16b	G	A	2: 158,751,178	D226N	probably damaging	Het
Prss36	T	C	7: 127,933,463	T739A	possibly damaging	Het
Psme2	A	T	14: 55,589,617		probably null	Het
Ptprb	T	G	10: 116,367,590	V1802G	probably damaging	Het
Rabep2	C	A	7: 126,435,676	Y84*	probably null	Het
Rbbp6	T	G	7: 123,001,293	S1508A	unknown	Het
Rel	A	T	11: 23,742,430	D534E	probably benign	Het
Rpgrip1	G	A	14: 52,159,395	S1258N	probably damaging	Het
Rprml	T	C	11: 103,650,127	L116P	probably damaging	Het
Rsph10b	A	G	5: 143,950,294	T323A	possibly damaging	Het
Rtn4rl1	A	G	11: 75,265,273	H177R	probably damaging	Het
Sag	A	G	1: 87,810,310	T24A	probably benign	Het
Scgb2b26	G	T	7: 33,944,359	T52N	probably damaging	Het
Scn10a	T	C	9: 119,672,128	I197V	probably damaging	Het
Sec24c	T	A	14: 20,692,859	V1003D	possibly damaging	Het
Sirt2	G	A	7: 28,771,836	G30E	probably damaging	Het
Slc13a5	T	A	11: 72,259,093	Q197L	probably benign	Het
Slc44a3	A	T	3: 121,490,269	S445T	probably damaging	Het
Slc7a7	A	T	14: 54,372,992	V399E	probably benign	Het
Smarcad1	T	A	6: 65,111,881	D1000E	probably benign	Het
Sorcs2	G	T	5: 36,039,313	Q663K	probably benign	Het
Stat4	A	G	1: 52,079,832	R345G	probably null	Het
Sycp2	G	A	2: 178,350,975	R1261C	probably damaging	Het
Tcf19	T	C	17: 35,514,484	I259V	probably benign	Het
Thada	T	A	17: 84,229,209	R1636S	probably benign	Het
Tnrc6c	T	C	11: 117,714,135	L32P	probably benign	Het
Tonsl	G	A	15: 76,632,876	T881I	probably benign	Het
Tonsl	A	C	15: 76,634,063	C570G	probably damaging	Het
Ube2o	C	A	11: 116,541,447	E898*	probably null	Het
Usp5	T	C	6: 124,817,431	H762R	possibly damaging	Het
Vmn2r15	A	G	5: 109,286,913	S642P	probably benign	Het
Vps13d	A	C	4: 145,085,407	I3343M		Het
Wbp11	T	C	6: 136,822,934	K83E	probably damaging	Het
Zfp26	T	A	9: 20,444,905	N36Y	possibly damaging	Het
Zfp57	T	A	17: 37,010,046	I264N	probably damaging	Het

Other mutations in Vmn2r23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Vmn2r23	APN	6	123729725	missense	possibly damaging	0.89
IGL01012:Vmn2r23	APN	6	123729596	missense	probably benign
IGL01073:Vmn2r23	APN	6	123712800	missense	possibly damaging	0.82
IGL01547:Vmn2r23	APN	6	123704424	missense	possibly damaging	0.88
IGL01571:Vmn2r23	APN	6	123704407	missense	probably damaging	1.00
IGL01950:Vmn2r23	APN	6	123741886	missense	possibly damaging	0.80
IGL02028:Vmn2r23	APN	6	123741860	missense	probably damaging	1.00
IGL02248:Vmn2r23	APN	6	123741744	missense	probably damaging	0.96
IGL02318:Vmn2r23	APN	6	123741836	missense	probably benign	0.10
IGL02649:Vmn2r23	APN	6	123704478	missense	probably benign
IGL02831:Vmn2r23	APN	6	123704385	missense	probably benign	0.22
IGL02832:Vmn2r23	APN	6	123704396	missense	probably benign	0.00
IGL02865:Vmn2r23	APN	6	123741619	missense	probably damaging	1.00
IGL02964:Vmn2r23	APN	6	123741782	missense	possibly damaging	0.93
IGL03347:Vmn2r23	APN	6	123704374	missense	probably benign	0.01
IGL03396:Vmn2r23	APN	6	123729626	missense	probably damaging	1.00
PIT4472001:Vmn2r23	UTSW	6	123712977	missense	possibly damaging	0.62
R0597:Vmn2r23	UTSW	6	123729721	missense	probably benign	0.08
R0677:Vmn2r23	UTSW	6	123713451	missense	probably benign	0.00
R0904:Vmn2r23	UTSW	6	123742135	missense	probably damaging	1.00
R1330:Vmn2r23	UTSW	6	123742004	missense	probably damaging	1.00
R1424:Vmn2r23	UTSW	6	123713270	nonsense	probably null
R1629:Vmn2r23	UTSW	6	123713427	missense	probably benign	0.05
R1842:Vmn2r23	UTSW	6	123729690	missense	possibly damaging	0.77
R1867:Vmn2r23	UTSW	6	123702915	missense	probably damaging	1.00
R1919:Vmn2r23	UTSW	6	123713010	missense	possibly damaging	0.94
R2087:Vmn2r23	UTSW	6	123741499	missense	probably benign	0.00
R2338:Vmn2r23	UTSW	6	123704425	missense	possibly damaging	0.88
R2568:Vmn2r23	UTSW	6	123742188	nonsense	probably null
R2867:Vmn2r23	UTSW	6	123713164	missense	possibly damaging	0.94
R2867:Vmn2r23	UTSW	6	123713164	missense	possibly damaging	0.94
R3500:Vmn2r23	UTSW	6	123713170	missense	possibly damaging	0.81
R3789:Vmn2r23	UTSW	6	123741389	missense	probably damaging	1.00
R4164:Vmn2r23	UTSW	6	123729738	missense	probably benign
R4506:Vmn2r23	UTSW	6	123702925	missense	probably damaging	1.00
R4652:Vmn2r23	UTSW	6	123741730	missense	probably damaging	1.00
R4697:Vmn2r23	UTSW	6	123741826	missense	probably damaging	1.00
R4840:Vmn2r23	UTSW	6	123713074	missense	probably damaging	1.00
R4983:Vmn2r23	UTSW	6	123733349	missense	probably damaging	1.00
R5276:Vmn2r23	UTSW	6	123712977	missense	possibly damaging	0.62
R5392:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R5528:Vmn2r23	UTSW	6	123713002	missense	probably damaging	1.00
R5529:Vmn2r23	UTSW	6	123713451	missense	probably benign	0.00
R5664:Vmn2r23	UTSW	6	123713074	missense	probably damaging	1.00
R5749:Vmn2r23	UTSW	6	123733273	missense	probably benign
R5761:Vmn2r23	UTSW	6	123712759	missense	probably benign	0.39
R5762:Vmn2r23	UTSW	6	123733393	missense	probably damaging	1.00
R5868:Vmn2r23	UTSW	6	123712942	missense	probably benign	0.12
R5935:Vmn2r23	UTSW	6	123741895	missense	possibly damaging	0.94
R6242:Vmn2r23	UTSW	6	123704400	missense	possibly damaging	0.82
R6416:Vmn2r23	UTSW	6	123712902	missense	probably damaging	1.00
R6524:Vmn2r23	UTSW	6	123713425	missense	probably damaging	1.00
R6576:Vmn2r23	UTSW	6	123733273	missense	probably benign
R6925:Vmn2r23	UTSW	6	123704553	missense	probably damaging	1.00
R7148:Vmn2r23	UTSW	6	123713022	missense	probably benign
R7215:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R7252:Vmn2r23	UTSW	6	123741581	missense	probably damaging	0.97
R7403:Vmn2r23	UTSW	6	123704579	missense	probably benign	0.01
R8015:Vmn2r23	UTSW	6	123704541	missense	probably benign	0.00
R8143:Vmn2r23	UTSW	6	123741353	missense	probably damaging	0.99
R8474:Vmn2r23	UTSW	6	123704640	missense	probably benign	0.36
R8520:Vmn2r23	UTSW	6	123741656	missense	probably damaging	0.99
R8713:Vmn2r23	UTSW	6	123703032	missense
R8966:Vmn2r23	UTSW	6	123742120	missense	possibly damaging	0.94
R9124:Vmn2r23	UTSW	6	123742079	missense	possibly damaging	0.57
R9163:Vmn2r23	UTSW	6	123741823	missense	probably damaging	1.00
R9189:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R9451:Vmn2r23	UTSW	6	123733393	missense	probably damaging	1.00
R9495:Vmn2r23	UTSW	6	123712713	missense	probably benign	0.30
R9514:Vmn2r23	UTSW	6	123712713	missense	probably benign	0.30
RF018:Vmn2r23	UTSW	6	123713116	missense	probably benign	0.00
T0975:Vmn2r23	UTSW	6	123713161	missense	probably benign	0.00
Z1088:Vmn2r23	UTSW	6	123742108	missense	probably damaging	0.98
Z1177:Vmn2r23	UTSW	6	123729725	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TGTGAACAAAATGGCAGCC -3'
(R):5'- GCATCAAATGTGGCTAAAATCCC -3'

Sequencing Primer
(F):5'- AATGGCAGCCTGAGCAC -3'
(R):5'- GTGGCTAAAATCCCTTAAAATATGCC -3'

Posted On

2021-03-08