Incidental Mutation 'R8679:Vmn2r23'
ID 661583
Institutional Source Beutler Lab
Gene Symbol Vmn2r23
Ensembl Gene ENSMUSG00000091620
Gene Name vomeronasal 2, receptor 23
Synonyms EG435916
MMRRC Submission 068534-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R8679 (G1)
Quality Score 108.008
Status Validated
Chromosome 6
Chromosomal Location 123679780-123719198 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 123690431 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 436 (W436R)
Ref Sequence ENSEMBL: ENSMUSP00000126682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172391]
AlphaFold E9PXI5
Predicted Effect probably damaging
Transcript: ENSMUST00000172391
AA Change: W436R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: W436R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 79 461 1.7e-31 PFAM
Pfam:NCD3G 513 566 1.2e-23 PFAM
Pfam:7tm_3 596 834 1.5e-55 PFAM
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency 98% (91/93)
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 T C 16: 20,152,479 (GRCm39) T1356A possibly damaging Het
Ace3 A G 11: 105,886,701 (GRCm39) T154A probably benign Het
Arhgap31 C A 16: 38,422,966 (GRCm39) Q1033H probably damaging Het
C1qtnf1 C T 11: 118,337,340 (GRCm39) R57* probably null Het
Cacna1g T C 11: 94,319,962 (GRCm39) T1405A probably damaging Het
Cacna1i A G 15: 80,260,011 (GRCm39) probably benign Het
Cdca4 T A 12: 112,785,734 (GRCm39) probably null Het
Cpa4 T A 6: 30,585,158 (GRCm39) M314K probably damaging Het
Cpn2 A T 16: 30,078,085 (GRCm39) S539T possibly damaging Het
Crebbp A G 16: 3,902,322 (GRCm39) S2306P probably damaging Het
Cspg4b A G 13: 113,488,163 (GRCm39) R9G Het
Dcaf5 T C 12: 80,385,807 (GRCm39) H773R probably benign Het
Dcun1d2 A T 8: 13,311,406 (GRCm39) D194E probably benign Het
Dnah1 G T 14: 30,989,767 (GRCm39) R3250S possibly damaging Het
Dnajc25 A C 4: 59,020,195 (GRCm39) K206T possibly damaging Het
Dnajc27 T C 12: 4,146,325 (GRCm39) L118P possibly damaging Het
Etl4 C T 2: 20,714,288 (GRCm39) T129I probably damaging Het
Faap100 A G 11: 120,263,003 (GRCm39) I785T probably damaging Het
Fam227b A T 2: 125,830,928 (GRCm39) D425E probably benign Het
Fat4 C G 3: 39,064,842 (GRCm39) L4933V probably damaging Het
Fbrsl1 A G 5: 110,526,086 (GRCm39) F39L probably damaging Het
Fezf1 A G 6: 23,247,769 (GRCm39) V102A probably benign Het
Gabra2 T C 5: 71,170,040 (GRCm39) probably benign Het
Garnl3 C A 2: 32,916,106 (GRCm39) R346L probably damaging Het
Grin2a A T 16: 9,403,089 (GRCm39) I799N possibly damaging Het
Hspa4 A G 11: 53,160,691 (GRCm39) F462L probably damaging Het
Iars1 C A 13: 49,856,675 (GRCm39) probably benign Het
Igkv6-32 C T 6: 70,051,063 (GRCm39) V98M possibly damaging Het
Il31ra A G 13: 112,662,372 (GRCm39) F560S possibly damaging Het
Itpr3 G A 17: 27,337,651 (GRCm39) probably benign Het
Kif2a G A 13: 107,116,049 (GRCm39) T299I probably damaging Het
Leo1 T A 9: 75,373,544 (GRCm39) Y656* probably null Het
Lpcat2 T A 8: 93,635,864 (GRCm39) V422D probably damaging Het
Lrrcc1 T A 3: 14,601,084 (GRCm39) S39T probably benign Het
Macf1 A T 4: 123,405,869 (GRCm39) S341T probably benign Het
Mc2r T A 18: 68,540,879 (GRCm39) Y138F probably damaging Het
Mepe A G 5: 104,485,754 (GRCm39) N298S possibly damaging Het
Mmp15 C A 8: 96,092,982 (GRCm39) N120K possibly damaging Het
Mrps9 A G 1: 42,918,915 (GRCm39) R106G probably damaging Het
Muc16 T A 9: 18,557,744 (GRCm39) M2850L unknown Het
Mxra8 T A 4: 155,927,122 (GRCm39) I352N probably damaging Het
Myo16 G A 8: 10,411,042 (GRCm39) V167I unknown Het
Neb T C 2: 52,215,051 (GRCm39) D209G probably damaging Het
Nlgn2 A G 11: 69,716,309 (GRCm39) V744A probably benign Het
Notch2 A G 3: 98,029,218 (GRCm39) probably null Het
Nr1d1 G C 11: 98,660,073 (GRCm39) R484G probably damaging Het
Or14c42-ps1 A T 7: 86,211,147 (GRCm39) H69L unknown Het
Or5ak20 T C 2: 85,183,953 (GRCm39) T106A probably benign Het
Or5k16 G A 16: 58,736,843 (GRCm39) R54C probably benign Het
Or9k2b T C 10: 130,016,702 (GRCm39) I16V probably benign Het
Oxa1l A G 14: 54,605,248 (GRCm39) probably null Het
Piwil4 T C 9: 14,616,322 (GRCm39) D15G Het
Plcz1 C A 6: 139,949,612 (GRCm39) W461L probably damaging Het
Plek A T 11: 16,944,676 (GRCm39) I118N probably damaging Het
Poc1b C A 10: 99,000,728 (GRCm39) probably benign Het
Potefam1 A T 2: 111,059,567 (GRCm39) M64K possibly damaging Het
Ppp1r16b G A 2: 158,593,098 (GRCm39) D226N probably damaging Het
Prss36 T C 7: 127,532,635 (GRCm39) T739A possibly damaging Het
Psme2 A T 14: 55,827,074 (GRCm39) probably null Het
Ptprb T G 10: 116,203,495 (GRCm39) V1802G probably damaging Het
Rabep2 C A 7: 126,034,848 (GRCm39) Y84* probably null Het
Rbbp6 T G 7: 122,600,516 (GRCm39) S1508A unknown Het
Rel A T 11: 23,692,430 (GRCm39) D534E probably benign Het
Rpgrip1 G A 14: 52,396,852 (GRCm39) S1258N probably damaging Het
Rprml T C 11: 103,540,953 (GRCm39) L116P probably damaging Het
Rsph10b A G 5: 143,887,112 (GRCm39) T323A possibly damaging Het
Rtn4rl1 A G 11: 75,156,099 (GRCm39) H177R probably damaging Het
Sag A G 1: 87,738,032 (GRCm39) T24A probably benign Het
Scgb2b26 G T 7: 33,643,784 (GRCm39) T52N probably damaging Het
Scn10a T C 9: 119,501,194 (GRCm39) I197V probably damaging Het
Sec24c T A 14: 20,742,927 (GRCm39) V1003D possibly damaging Het
Sirt2 G A 7: 28,471,261 (GRCm39) G30E probably damaging Het
Slc13a5 T A 11: 72,149,919 (GRCm39) Q197L probably benign Het
Slc44a3 A T 3: 121,283,918 (GRCm39) S445T probably damaging Het
Slc7a7 A T 14: 54,610,449 (GRCm39) V399E probably benign Het
Smarcad1 T A 6: 65,088,865 (GRCm39) D1000E probably benign Het
Sorcs2 G T 5: 36,196,657 (GRCm39) Q663K probably benign Het
Stat4 A G 1: 52,118,991 (GRCm39) R345G probably null Het
Sycp2 G A 2: 177,992,768 (GRCm39) R1261C probably damaging Het
Tcf19 T C 17: 35,825,381 (GRCm39) I259V probably benign Het
Thada T A 17: 84,536,637 (GRCm39) R1636S probably benign Het
Tnrc6c T C 11: 117,604,961 (GRCm39) L32P probably benign Het
Tonsl G A 15: 76,517,076 (GRCm39) T881I probably benign Het
Tonsl A C 15: 76,518,263 (GRCm39) C570G probably damaging Het
Ube2o C A 11: 116,432,273 (GRCm39) E898* probably null Het
Usp5 T C 6: 124,794,394 (GRCm39) H762R possibly damaging Het
Vmn2r15 A G 5: 109,434,779 (GRCm39) S642P probably benign Het
Vps13d A C 4: 144,811,977 (GRCm39) I3343M Het
Wbp11 T C 6: 136,799,932 (GRCm39) K83E probably damaging Het
Zfp26 T A 9: 20,356,201 (GRCm39) N36Y possibly damaging Het
Zfp57 T A 17: 37,320,938 (GRCm39) I264N probably damaging Het
Other mutations in Vmn2r23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Vmn2r23 APN 6 123,706,684 (GRCm39) missense possibly damaging 0.89
IGL01012:Vmn2r23 APN 6 123,706,555 (GRCm39) missense probably benign
IGL01073:Vmn2r23 APN 6 123,689,759 (GRCm39) missense possibly damaging 0.82
IGL01547:Vmn2r23 APN 6 123,681,383 (GRCm39) missense possibly damaging 0.88
IGL01571:Vmn2r23 APN 6 123,681,366 (GRCm39) missense probably damaging 1.00
IGL01950:Vmn2r23 APN 6 123,718,845 (GRCm39) missense possibly damaging 0.80
IGL02028:Vmn2r23 APN 6 123,718,819 (GRCm39) missense probably damaging 1.00
IGL02248:Vmn2r23 APN 6 123,718,703 (GRCm39) missense probably damaging 0.96
IGL02318:Vmn2r23 APN 6 123,718,795 (GRCm39) missense probably benign 0.10
IGL02649:Vmn2r23 APN 6 123,681,437 (GRCm39) missense probably benign
IGL02831:Vmn2r23 APN 6 123,681,344 (GRCm39) missense probably benign 0.22
IGL02832:Vmn2r23 APN 6 123,681,355 (GRCm39) missense probably benign 0.00
IGL02865:Vmn2r23 APN 6 123,718,578 (GRCm39) missense probably damaging 1.00
IGL02964:Vmn2r23 APN 6 123,718,741 (GRCm39) missense possibly damaging 0.93
IGL03347:Vmn2r23 APN 6 123,681,333 (GRCm39) missense probably benign 0.01
IGL03396:Vmn2r23 APN 6 123,706,585 (GRCm39) missense probably damaging 1.00
PIT4472001:Vmn2r23 UTSW 6 123,689,936 (GRCm39) missense possibly damaging 0.62
R0597:Vmn2r23 UTSW 6 123,706,680 (GRCm39) missense probably benign 0.08
R0677:Vmn2r23 UTSW 6 123,690,410 (GRCm39) missense probably benign 0.00
R0904:Vmn2r23 UTSW 6 123,719,094 (GRCm39) missense probably damaging 1.00
R1330:Vmn2r23 UTSW 6 123,718,963 (GRCm39) missense probably damaging 1.00
R1424:Vmn2r23 UTSW 6 123,690,229 (GRCm39) nonsense probably null
R1629:Vmn2r23 UTSW 6 123,690,386 (GRCm39) missense probably benign 0.05
R1842:Vmn2r23 UTSW 6 123,706,649 (GRCm39) missense possibly damaging 0.77
R1867:Vmn2r23 UTSW 6 123,679,874 (GRCm39) missense probably damaging 1.00
R1919:Vmn2r23 UTSW 6 123,689,969 (GRCm39) missense possibly damaging 0.94
R2087:Vmn2r23 UTSW 6 123,718,458 (GRCm39) missense probably benign 0.00
R2338:Vmn2r23 UTSW 6 123,681,384 (GRCm39) missense possibly damaging 0.88
R2568:Vmn2r23 UTSW 6 123,719,147 (GRCm39) nonsense probably null
R2867:Vmn2r23 UTSW 6 123,690,123 (GRCm39) missense possibly damaging 0.94
R2867:Vmn2r23 UTSW 6 123,690,123 (GRCm39) missense possibly damaging 0.94
R3500:Vmn2r23 UTSW 6 123,690,129 (GRCm39) missense possibly damaging 0.81
R3789:Vmn2r23 UTSW 6 123,718,348 (GRCm39) missense probably damaging 1.00
R4164:Vmn2r23 UTSW 6 123,706,697 (GRCm39) missense probably benign
R4506:Vmn2r23 UTSW 6 123,679,884 (GRCm39) missense probably damaging 1.00
R4652:Vmn2r23 UTSW 6 123,718,689 (GRCm39) missense probably damaging 1.00
R4697:Vmn2r23 UTSW 6 123,718,785 (GRCm39) missense probably damaging 1.00
R4840:Vmn2r23 UTSW 6 123,690,033 (GRCm39) missense probably damaging 1.00
R4983:Vmn2r23 UTSW 6 123,710,308 (GRCm39) missense probably damaging 1.00
R5276:Vmn2r23 UTSW 6 123,689,936 (GRCm39) missense possibly damaging 0.62
R5392:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R5528:Vmn2r23 UTSW 6 123,689,961 (GRCm39) missense probably damaging 1.00
R5529:Vmn2r23 UTSW 6 123,690,410 (GRCm39) missense probably benign 0.00
R5664:Vmn2r23 UTSW 6 123,690,033 (GRCm39) missense probably damaging 1.00
R5749:Vmn2r23 UTSW 6 123,710,232 (GRCm39) missense probably benign
R5761:Vmn2r23 UTSW 6 123,689,718 (GRCm39) missense probably benign 0.39
R5762:Vmn2r23 UTSW 6 123,710,352 (GRCm39) missense probably damaging 1.00
R5868:Vmn2r23 UTSW 6 123,689,901 (GRCm39) missense probably benign 0.12
R5935:Vmn2r23 UTSW 6 123,718,854 (GRCm39) missense possibly damaging 0.94
R6242:Vmn2r23 UTSW 6 123,681,359 (GRCm39) missense possibly damaging 0.82
R6416:Vmn2r23 UTSW 6 123,689,861 (GRCm39) missense probably damaging 1.00
R6524:Vmn2r23 UTSW 6 123,690,384 (GRCm39) missense probably damaging 1.00
R6576:Vmn2r23 UTSW 6 123,710,232 (GRCm39) missense probably benign
R6925:Vmn2r23 UTSW 6 123,681,512 (GRCm39) missense probably damaging 1.00
R7148:Vmn2r23 UTSW 6 123,689,981 (GRCm39) missense probably benign
R7215:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R7252:Vmn2r23 UTSW 6 123,718,540 (GRCm39) missense probably damaging 0.97
R7403:Vmn2r23 UTSW 6 123,681,538 (GRCm39) missense probably benign 0.01
R8015:Vmn2r23 UTSW 6 123,681,500 (GRCm39) missense probably benign 0.00
R8143:Vmn2r23 UTSW 6 123,718,312 (GRCm39) missense probably damaging 0.99
R8474:Vmn2r23 UTSW 6 123,681,599 (GRCm39) missense probably benign 0.36
R8520:Vmn2r23 UTSW 6 123,718,615 (GRCm39) missense probably damaging 0.99
R8713:Vmn2r23 UTSW 6 123,679,991 (GRCm39) missense
R8966:Vmn2r23 UTSW 6 123,719,079 (GRCm39) missense possibly damaging 0.94
R9124:Vmn2r23 UTSW 6 123,719,038 (GRCm39) missense possibly damaging 0.57
R9163:Vmn2r23 UTSW 6 123,718,782 (GRCm39) missense probably damaging 1.00
R9189:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R9451:Vmn2r23 UTSW 6 123,710,352 (GRCm39) missense probably damaging 1.00
R9495:Vmn2r23 UTSW 6 123,689,672 (GRCm39) missense probably benign 0.30
R9514:Vmn2r23 UTSW 6 123,689,672 (GRCm39) missense probably benign 0.30
RF018:Vmn2r23 UTSW 6 123,690,075 (GRCm39) missense probably benign 0.00
T0975:Vmn2r23 UTSW 6 123,690,120 (GRCm39) missense probably benign 0.00
Z1088:Vmn2r23 UTSW 6 123,719,067 (GRCm39) missense probably damaging 0.98
Z1177:Vmn2r23 UTSW 6 123,706,684 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGTGAACAAAATGGCAGCC -3'
(R):5'- GCATCAAATGTGGCTAAAATCCC -3'

Sequencing Primer
(F):5'- AATGGCAGCCTGAGCAC -3'
(R):5'- GTGGCTAAAATCCCTTAAAATATGCC -3'
Posted On 2021-03-08