Incidental Mutation 'R8679:Myo16'
ID 661593
Institutional Source Beutler Lab
Gene Symbol Myo16
Ensembl Gene ENSMUSG00000039057
Gene Name myosin XVI
Synonyms BM140241, C230040D10Rik, Nyap3
MMRRC Submission
Accession Numbers

Genbank: NM_001081397; MGI: 2685951

Is this an essential gene? Possibly non essential (E-score: 0.491) question?
Stock # R8679 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 10153911-10634742 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 10361042 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 167 (V167I)
Ref Sequence ENSEMBL: ENSMUSP00000146677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042103] [ENSMUST00000207204] [ENSMUST00000207477] [ENSMUST00000208309] [ENSMUST00000214643]
AlphaFold Q5DU14
Predicted Effect probably benign
Transcript: ENSMUST00000042103
AA Change: V167I

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000049345
Gene: ENSMUSG00000039057
AA Change: V167I

DomainStartEndE-ValueType
ANK 92 121 1.65e-1 SMART
ANK 125 154 3.46e-4 SMART
ANK 158 189 2.11e2 SMART
ANK 221 250 2.85e-5 SMART
ANK 254 283 3.51e-5 SMART
low complexity region 333 349 N/A INTRINSIC
MYSc 394 1144 2.27e-144 SMART
IQ 1144 1166 4.06e-2 SMART
Pfam:NYAP_N 1207 1591 4.1e-135 PFAM
low complexity region 1670 1690 N/A INTRINSIC
low complexity region 1841 1860 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000207204
AA Change: V167I
Predicted Effect unknown
Transcript: ENSMUST00000207477
AA Change: V167I
Predicted Effect probably benign
Transcript: ENSMUST00000208309
AA Change: V167I

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000214643
AA Change: V189I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.1162 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency 98% (91/93)
MGI Phenotype PHENOTYPE: Triple KO of Nyap1, Nyap2 and Myo16 results in decreased brain weight and cortex and striatum size and reduced neurite length in cortical neurons. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A T 2: 111,229,222 M64K possibly damaging Het
Abcc5 T C 16: 20,333,729 T1356A possibly damaging Het
Ace3 A G 11: 105,995,875 T154A probably benign Het
Arhgap31 C A 16: 38,602,604 Q1033H probably damaging Het
BC067074 A G 13: 113,351,629 R9G Het
C1qtnf1 C T 11: 118,446,514 R57* probably null Het
Cacna1g T C 11: 94,429,136 T1405A probably damaging Het
Cacna1i A G 15: 80,375,810 probably benign Het
Cdca4 T A 12: 112,822,114 probably null Het
Cpa4 T A 6: 30,585,159 M314K probably damaging Het
Cpn2 A T 16: 30,259,267 S539T possibly damaging Het
Crebbp A G 16: 4,084,458 S2306P probably damaging Het
Dcaf5 T C 12: 80,339,033 H773R probably benign Het
Dcun1d2 A T 8: 13,261,406 D194E probably benign Het
Dnah1 G T 14: 31,267,810 R3250S possibly damaging Het
Dnajc25 A C 4: 59,020,195 K206T possibly damaging Het
Dnajc27 T C 12: 4,096,325 L118P possibly damaging Het
Etl4 C T 2: 20,709,477 T129I probably damaging Het
Faap100 A G 11: 120,372,177 I785T probably damaging Het
Fam227b A T 2: 125,989,008 D425E probably benign Het
Fat4 C G 3: 39,010,693 L4933V probably damaging Het
Fbrsl1 A G 5: 110,378,220 F39L probably damaging Het
Fezf1 A G 6: 23,247,770 V102A probably benign Het
Gabra2 T C 5: 71,012,697 probably benign Het
Garnl3 C A 2: 33,026,094 R346L probably damaging Het
Grin2a A T 16: 9,585,225 I799N possibly damaging Het
Hspa4 A G 11: 53,269,864 F462L probably damaging Het
Iars C A 13: 49,703,199 probably benign Het
Igkv6-32 C T 6: 70,074,079 V98M possibly damaging Het
Il31ra A G 13: 112,525,838 F560S possibly damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kif2a G A 13: 106,979,541 T299I probably damaging Het
Leo1 T A 9: 75,466,262 Y656* probably null Het
Lpcat2 T A 8: 92,909,236 V422D probably damaging Het
Lrrcc1 T A 3: 14,536,024 S39T probably benign Het
Macf1 A T 4: 123,512,076 S341T probably benign Het
Mc2r T A 18: 68,407,808 Y138F probably damaging Het
Mepe A G 5: 104,337,888 N298S possibly damaging Het
Mmp15 C A 8: 95,366,354 N120K possibly damaging Het
Mrps9 A G 1: 42,879,755 R106G probably damaging Het
Muc16 T A 9: 18,646,448 M2850L unknown Het
Mxra8 T A 4: 155,842,665 I352N probably damaging Het
Neb T C 2: 52,325,039 D209G probably damaging Het
Nlgn2 A G 11: 69,825,483 V744A probably benign Het
Notch2 A G 3: 98,121,902 probably null Het
Nr1d1 G C 11: 98,769,247 R484G probably damaging Het
Olfr180 G A 16: 58,916,480 R54C probably benign Het
Olfr296-ps1 A T 7: 86,561,939 H69L unknown Het
Olfr826 T C 10: 130,180,833 I16V probably benign Het
Olfr988 T C 2: 85,353,609 T106A probably benign Het
Oxa1l A G 14: 54,367,791 probably null Het
Piwil4 T C 9: 14,705,026 D15G Het
Plcz1 C A 6: 140,003,886 W461L probably damaging Het
Plek A T 11: 16,994,676 I118N probably damaging Het
Poc1b C A 10: 99,164,866 probably benign Het
Ppp1r16b G A 2: 158,751,178 D226N probably damaging Het
Prss36 T C 7: 127,933,463 T739A possibly damaging Het
Psme2 A T 14: 55,589,617 probably null Het
Ptprb T G 10: 116,367,590 V1802G probably damaging Het
Rabep2 C A 7: 126,435,676 Y84* probably null Het
Rbbp6 T G 7: 123,001,293 S1508A unknown Het
Rel A T 11: 23,742,430 D534E probably benign Het
Rpgrip1 G A 14: 52,159,395 S1258N probably damaging Het
Rprml T C 11: 103,650,127 L116P probably damaging Het
Rsph10b A G 5: 143,950,294 T323A possibly damaging Het
Rtn4rl1 A G 11: 75,265,273 H177R probably damaging Het
Sag A G 1: 87,810,310 T24A probably benign Het
Scgb2b26 G T 7: 33,944,359 T52N probably damaging Het
Scn10a T C 9: 119,672,128 I197V probably damaging Het
Sec24c T A 14: 20,692,859 V1003D possibly damaging Het
Sirt2 G A 7: 28,771,836 G30E probably damaging Het
Slc13a5 T A 11: 72,259,093 Q197L probably benign Het
Slc44a3 A T 3: 121,490,269 S445T probably damaging Het
Slc7a7 A T 14: 54,372,992 V399E probably benign Het
Smarcad1 T A 6: 65,111,881 D1000E probably benign Het
Sorcs2 G T 5: 36,039,313 Q663K probably benign Het
Stat4 A G 1: 52,079,832 R345G probably null Het
Sycp2 G A 2: 178,350,975 R1261C probably damaging Het
Tcf19 T C 17: 35,514,484 I259V probably benign Het
Thada T A 17: 84,229,209 R1636S probably benign Het
Tnrc6c T C 11: 117,714,135 L32P probably benign Het
Tonsl G A 15: 76,632,876 T881I probably benign Het
Tonsl A C 15: 76,634,063 C570G probably damaging Het
Ube2o C A 11: 116,541,447 E898* probably null Het
Usp5 T C 6: 124,817,431 H762R possibly damaging Het
Vmn2r15 A G 5: 109,286,913 S642P probably benign Het
Vmn2r23 T C 6: 123,713,472 W436R probably damaging Het
Vps13d A C 4: 145,085,407 I3343M Het
Wbp11 T C 6: 136,822,934 K83E probably damaging Het
Zfp26 T A 9: 20,444,905 N36Y possibly damaging Het
Zfp57 T A 17: 37,010,046 I264N probably damaging Het
Other mutations in Myo16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Myo16 APN 8 10438889 missense probably damaging 1.00
IGL00567:Myo16 APN 8 10462154 missense probably damaging 1.00
IGL00671:Myo16 APN 8 10361067 missense probably damaging 1.00
IGL00897:Myo16 APN 8 10315518 missense probably damaging 1.00
IGL01458:Myo16 APN 8 10435853 missense probably damaging 1.00
IGL01523:Myo16 APN 8 10370908 missense probably damaging 1.00
IGL01532:Myo16 APN 8 10400551 missense probably benign 0.00
IGL01680:Myo16 APN 8 10272630 missense probably damaging 1.00
IGL01747:Myo16 APN 8 10604877 missense probably damaging 1.00
IGL02084:Myo16 APN 8 10361088 missense probably damaging 0.99
IGL02203:Myo16 APN 8 10570132 missense possibly damaging 0.52
IGL02506:Myo16 APN 8 10390217 missense probably damaging 1.00
IGL02819:Myo16 APN 8 10322600 missense probably damaging 1.00
IGL02935:Myo16 APN 8 10532990 missense probably benign 0.41
IGL02943:Myo16 APN 8 10400595 splice site probably benign
IGL03347:Myo16 APN 8 10376120 critical splice acceptor site probably null
3-1:Myo16 UTSW 8 10438869 missense probably damaging 0.99
P0016:Myo16 UTSW 8 10400596 splice site probably benign
R0006:Myo16 UTSW 8 10475988 missense probably damaging 0.98
R0006:Myo16 UTSW 8 10475988 missense probably damaging 0.98
R0033:Myo16 UTSW 8 10370955 missense probably damaging 1.00
R0033:Myo16 UTSW 8 10370955 missense probably damaging 1.00
R0142:Myo16 UTSW 8 10569790 missense probably benign 0.01
R0195:Myo16 UTSW 8 10315538 splice site probably benign
R0418:Myo16 UTSW 8 10569918 missense probably benign 0.01
R0576:Myo16 UTSW 8 10562318 critical splice donor site probably null
R0627:Myo16 UTSW 8 10439689 missense probably benign 0.15
R0826:Myo16 UTSW 8 10376285 splice site probably benign
R0835:Myo16 UTSW 8 10272766 missense probably damaging 1.00
R1015:Myo16 UTSW 8 10390183 missense probably benign 0.17
R1052:Myo16 UTSW 8 10570181 missense possibly damaging 0.92
R1180:Myo16 UTSW 8 10396908 missense probably damaging 1.00
R1185:Myo16 UTSW 8 10633624 missense probably damaging 1.00
R1185:Myo16 UTSW 8 10633624 missense probably damaging 1.00
R1474:Myo16 UTSW 8 10502796 missense probably damaging 1.00
R1484:Myo16 UTSW 8 10560145 missense probably damaging 1.00
R1503:Myo16 UTSW 8 10502817 missense probably benign 0.44
R1733:Myo16 UTSW 8 10442283 missense probably damaging 0.98
R1873:Myo16 UTSW 8 10272789 missense probably damaging 1.00
R1885:Myo16 UTSW 8 10322656 missense probably damaging 1.00
R1943:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2013:Myo16 UTSW 8 10502796 missense probably damaging 1.00
R2019:Myo16 UTSW 8 10376260 missense probably benign 0.05
R2022:Myo16 UTSW 8 10272633 missense probably benign 0.08
R2214:Myo16 UTSW 8 10438803 missense probably damaging 1.00
R2228:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2351:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2352:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2357:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2566:Myo16 UTSW 8 10594820 missense probably benign 0.43
R3402:Myo16 UTSW 8 10384719 missense probably benign
R3870:Myo16 UTSW 8 10442239 missense probably benign 0.25
R4080:Myo16 UTSW 8 10562240 missense probably damaging 1.00
R4498:Myo16 UTSW 8 10435869 missense probably benign 0.01
R4631:Myo16 UTSW 8 10506984 missense probably damaging 1.00
R4689:Myo16 UTSW 8 10438890 missense probably damaging 1.00
R4736:Myo16 UTSW 8 10373527 missense probably damaging 1.00
R4738:Myo16 UTSW 8 10373527 missense probably damaging 1.00
R4739:Myo16 UTSW 8 10373527 missense probably damaging 1.00
R4764:Myo16 UTSW 8 10435880 missense probably damaging 1.00
R4778:Myo16 UTSW 8 10569694 missense probably damaging 0.97
R4852:Myo16 UTSW 8 10373474 missense probably damaging 1.00
R4885:Myo16 UTSW 8 10438892 missense probably damaging 0.98
R4993:Myo16 UTSW 8 10476094 missense probably damaging 0.99
R5077:Myo16 UTSW 8 10322658 missense probably damaging 1.00
R5135:Myo16 UTSW 8 10476114 missense probably benign
R5170:Myo16 UTSW 8 10569745 missense probably benign 0.30
R5203:Myo16 UTSW 8 10360995 missense probably damaging 1.00
R5246:Myo16 UTSW 8 10562212 nonsense probably null
R5517:Myo16 UTSW 8 10560226 missense probably benign 0.22
R5567:Myo16 UTSW 8 10322676 missense probably damaging 1.00
R5694:Myo16 UTSW 8 10569606 missense probably benign 0.01
R5749:Myo16 UTSW 8 10413245 missense probably benign 0.01
R6131:Myo16 UTSW 8 10569877 missense probably benign
R6213:Myo16 UTSW 8 10370963 critical splice donor site probably null
R6216:Myo16 UTSW 8 10315494 missense probably benign 0.01
R6240:Myo16 UTSW 8 10370930 missense probably damaging 1.00
R6628:Myo16 UTSW 8 10570638 missense probably damaging 0.99
R6935:Myo16 UTSW 8 10569820 missense probably benign 0.37
R6996:Myo16 UTSW 8 10569496 missense probably damaging 1.00
R7103:Myo16 UTSW 8 10569673 missense unknown
R7164:Myo16 UTSW 8 10569585 missense unknown
R7255:Myo16 UTSW 8 10499169 missense unknown
R7266:Myo16 UTSW 8 10272687 missense unknown
R7319:Myo16 UTSW 8 10476185 splice site probably null
R7398:Myo16 UTSW 8 10562183 missense unknown
R7442:Myo16 UTSW 8 10272537 missense probably damaging 1.00
R7498:Myo16 UTSW 8 10400589 missense unknown
R7539:Myo16 UTSW 8 10361095 critical splice donor site probably null
R7622:Myo16 UTSW 8 10376238 missense unknown
R7794:Myo16 UTSW 8 10569913 missense unknown
R7903:Myo16 UTSW 8 10376265 missense probably null
R8055:Myo16 UTSW 8 10562186 missense unknown
R8078:Myo16 UTSW 8 10562078 missense unknown
R8081:Myo16 UTSW 8 10322743 missense unknown
R8700:Myo16 UTSW 8 10413172 missense unknown
R8939:Myo16 UTSW 8 10474679 missense probably damaging 0.99
R8955:Myo16 UTSW 8 10376175 missense probably damaging 1.00
R8968:Myo16 UTSW 8 10569700 missense unknown
R9187:Myo16 UTSW 8 10442233 missense unknown
R9219:Myo16 UTSW 8 10442236 missense unknown
R9287:Myo16 UTSW 8 10476114 missense unknown
R9327:Myo16 UTSW 8 10439705 critical splice donor site probably null
X0066:Myo16 UTSW 8 10376185 missense probably damaging 1.00
Z1177:Myo16 UTSW 8 10474691 missense unknown
Predicted Primers PCR Primer
(F):5'- AAAATCCCTCAGCAATGTGTCTG -3'
(R):5'- GGCGAGATAGAAAACTGCCTTG -3'

Sequencing Primer
(F):5'- TCCCTCAGCAATGTGTCTGATAAAAC -3'
(R):5'- GAAAACTGCCTTGTGTTACACC -3'
Posted On 2021-03-08