Incidental Mutation 'R8679:Mmp15'
ID661596
Institutional Source Beutler Lab
Gene Symbol Mmp15
Ensembl Gene ENSMUSG00000031790
Gene Namematrix metallopeptidase 15
SynonymsMembrane type 2-MMP, MT2-MMP
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8679 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location95352268-95375080 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 95366354 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 120 (N120K)
Ref Sequence ENSEMBL: ENSMUSP00000034243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034243]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034243
AA Change: N120K

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000034243
Gene: ENSMUSG00000031790
AA Change: N120K

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Pfam:PG_binding_1 42 102 3.2e-13 PFAM
ZnMc 131 301 5.31e-59 SMART
low complexity region 306 353 N/A INTRINSIC
HX 370 413 5.92e-8 SMART
HX 415 459 2.31e-10 SMART
HX 462 508 2.98e-13 SMART
HX 510 555 2.01e-10 SMART
Pfam:DUF3377 586 657 1.2e-32 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. A deficiency of the encoded protein in mice is compatible with normal development and postnatal growth. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A T 2: 111,229,222 M64K possibly damaging Het
Abcc5 T C 16: 20,333,729 T1356A possibly damaging Het
Ace3 A G 11: 105,995,875 T154A probably benign Het
Arhgap31 C A 16: 38,602,604 Q1033H probably damaging Het
BC067074 A G 13: 113,351,629 R9G Het
C1qtnf1 C T 11: 118,446,514 R57* probably null Het
Cacna1g T C 11: 94,429,136 T1405A probably damaging Het
Cdca4 T A 12: 112,822,114 probably null Het
Cpa4 T A 6: 30,585,159 M314K probably damaging Het
Cpn2 A T 16: 30,259,267 S539T possibly damaging Het
Crebbp A G 16: 4,084,458 S2306P probably damaging Het
Dcaf5 T C 12: 80,339,033 H773R probably benign Het
Dcun1d2 A T 8: 13,261,406 D194E probably benign Het
Dnah1 G T 14: 31,267,810 R3250S possibly damaging Het
Dnajc25 A C 4: 59,020,195 K206T possibly damaging Het
Dnajc27 T C 12: 4,096,325 L118P possibly damaging Het
Etl4 C T 2: 20,709,477 T129I probably damaging Het
Faap100 A G 11: 120,372,177 I785T probably damaging Het
Fam227b A T 2: 125,989,008 D425E probably benign Het
Fat4 C G 3: 39,010,693 L4933V probably damaging Het
Fbrsl1 A G 5: 110,378,220 F39L probably damaging Het
Fezf1 A G 6: 23,247,770 V102A probably benign Het
Garnl3 C A 2: 33,026,094 R346L probably damaging Het
Grin2a A T 16: 9,585,225 I799N possibly damaging Het
Hspa4 A G 11: 53,269,864 F462L probably damaging Het
Igkv6-32 C T 6: 70,074,079 V98M possibly damaging Het
Il31ra A G 13: 112,525,838 F560S possibly damaging Het
Kif2a G A 13: 106,979,541 T299I probably damaging Het
Leo1 T A 9: 75,466,262 Y656* probably null Het
Lpcat2 T A 8: 92,909,236 V422D probably damaging Het
Lrrcc1 T A 3: 14,536,024 S39T probably benign Het
Macf1 A T 4: 123,512,076 S341T probably benign Het
Mc2r T A 18: 68,407,808 Y138F probably damaging Het
Mepe A G 5: 104,337,888 N298S possibly damaging Het
Mrps9 A G 1: 42,879,755 R106G probably damaging Het
Muc16 T A 9: 18,646,448 M2850L unknown Het
Mxra8 T A 4: 155,842,665 I352N probably damaging Het
Myo16 G A 8: 10,361,042 V167I unknown Het
Neb T C 2: 52,325,039 D209G probably damaging Het
Nlgn2 A G 11: 69,825,483 V744A probably benign Het
Notch2 A G 3: 98,121,902 probably null Het
Nr1d1 G C 11: 98,769,247 R484G probably damaging Het
Olfr180 G A 16: 58,916,480 R54C probably benign Het
Olfr296-ps1 A T 7: 86,561,939 H69L unknown Het
Olfr826 T C 10: 130,180,833 I16V probably benign Het
Olfr988 T C 2: 85,353,609 T106A probably benign Het
Oxa1l A G 14: 54,367,791 probably null Het
Piwil4 T C 9: 14,705,026 D15G Het
Plcz1 C A 6: 140,003,886 W461L probably damaging Het
Plek A T 11: 16,994,676 I118N probably damaging Het
Ppp1r16b G A 2: 158,751,178 D226N probably damaging Het
Prss36 T C 7: 127,933,463 T739A possibly damaging Het
Psme2 A T 14: 55,589,617 probably null Het
Ptprb T G 10: 116,367,590 V1802G probably damaging Het
Rabep2 C A 7: 126,435,676 Y84* probably null Het
Rbbp6 T G 7: 123,001,293 S1508A unknown Het
Rel A T 11: 23,742,430 D534E probably benign Het
Rpgrip1 G A 14: 52,159,395 S1258N probably damaging Het
Rprml T C 11: 103,650,127 L116P probably damaging Het
Rsph10b A G 5: 143,950,294 T323A possibly damaging Het
Rtn4rl1 A G 11: 75,265,273 H177R probably damaging Het
Sag A G 1: 87,810,310 T24A probably benign Het
Scgb2b26 G T 7: 33,944,359 T52N probably damaging Het
Scn10a T C 9: 119,672,128 I197V probably damaging Het
Sec24c T A 14: 20,692,859 V1003D possibly damaging Het
Sirt2 G A 7: 28,771,836 G30E probably damaging Het
Slc13a5 T A 11: 72,259,093 Q197L probably benign Het
Slc44a3 A T 3: 121,490,269 S445T probably damaging Het
Slc7a7 A T 14: 54,372,992 V399E probably benign Het
Smarcad1 T A 6: 65,111,881 D1000E probably benign Het
Sorcs2 G T 5: 36,039,313 Q663K probably benign Het
Stat4 A G 1: 52,079,832 R345G probably null Het
Sycp2 G A 2: 178,350,975 R1261C probably damaging Het
Tcf19 T C 17: 35,514,484 I259V probably benign Het
Thada T A 17: 84,229,209 R1636S probably benign Het
Tnrc6c T C 11: 117,714,135 L32P probably benign Het
Tonsl G A 15: 76,632,876 T881I probably benign Het
Tonsl A C 15: 76,634,063 C570G probably damaging Het
Ube2o C A 11: 116,541,447 E898* probably null Het
Usp5 T C 6: 124,817,431 H762R possibly damaging Het
Vmn2r15 A G 5: 109,286,913 S642P probably benign Het
Vmn2r23 T C 6: 123,713,472 W436R probably damaging Het
Vps13d A C 4: 145,085,407 I3343M Het
Wbp11 T C 6: 136,822,934 K83E probably damaging Het
Zfp26 T A 9: 20,444,905 N36Y possibly damaging Het
Zfp57 T A 17: 37,010,046 I264N probably damaging Het
Other mutations in Mmp15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01467:Mmp15 APN 8 95366331 missense probably benign 0.31
IGL03001:Mmp15 APN 8 95368217 missense probably damaging 0.97
R0147:Mmp15 UTSW 8 95372317 missense probably benign 0.18
R0148:Mmp15 UTSW 8 95372317 missense probably benign 0.18
R0437:Mmp15 UTSW 8 95370772 missense probably benign 0.04
R0465:Mmp15 UTSW 8 95367998 missense probably damaging 1.00
R0548:Mmp15 UTSW 8 95372351 missense probably damaging 1.00
R0574:Mmp15 UTSW 8 95365401 missense possibly damaging 0.73
R0685:Mmp15 UTSW 8 95372134 missense possibly damaging 0.81
R0763:Mmp15 UTSW 8 95368228 missense probably benign 0.01
R1341:Mmp15 UTSW 8 95372303 missense probably benign 0.03
R1428:Mmp15 UTSW 8 95369562 missense probably benign 0.34
R1840:Mmp15 UTSW 8 95365420 missense probably damaging 1.00
R2061:Mmp15 UTSW 8 95370779 missense possibly damaging 0.91
R2219:Mmp15 UTSW 8 95370173 missense probably benign 0.38
R4760:Mmp15 UTSW 8 95368196 missense possibly damaging 0.61
R4762:Mmp15 UTSW 8 95372330 missense probably benign 0.00
R5233:Mmp15 UTSW 8 95371068 missense probably benign 0.08
R5394:Mmp15 UTSW 8 95366404 missense probably damaging 0.96
R5502:Mmp15 UTSW 8 95368184 missense possibly damaging 0.96
R5543:Mmp15 UTSW 8 95368101 missense possibly damaging 0.85
R6027:Mmp15 UTSW 8 95372176 missense probably benign 0.00
R6341:Mmp15 UTSW 8 95365463 critical splice donor site probably null
R6720:Mmp15 UTSW 8 95365314 missense probably benign 0.22
R7788:Mmp15 UTSW 8 95368148 missense probably damaging 1.00
R8033:Mmp15 UTSW 8 95367962 missense probably benign 0.01
R8791:Mmp15 UTSW 8 95369660 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAGTCACTCCTTAGCGTTCAATC -3'
(R):5'- AGGCCCTAGATTGTGAGCTG -3'

Sequencing Primer
(F):5'- AATCTCTTTACCCACTATTCTGGAAG -3'
(R):5'- CCCTAGATTGTGAGCTGGGACTG -3'
Posted On2021-03-08