Mutagenetix > Incidental Mutations

Incidental Mutation 'R8679:Ptprb'

661602

Institutional Source

Beutler Lab

Gene Symbol

Ptprb

Ensembl Gene

ENSMUSG00000020154

Gene Name

protein tyrosine phosphatase, receptor type, B

Synonyms

3230402H02Rik, VE-PTP

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8679 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

116275523-116389535 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 116367590 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 1802 (V1802G)

Ref Sequence

ENSEMBL: ENSMUSP00000089805 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092167] [ENSMUST00000218553]

AlphaFold

B2RU80

Predicted Effect

probably damaging
Transcript: ENSMUST00000092167
AA Change: V1802G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000089805
Gene: ENSMUSG00000020154
AA Change: V1802G

Domain	Start	End	E-Value	Type
FN3	22	102	8.23e1	SMART
FN3	111	193	1.73e-5	SMART
FN3	204	281	1.56e-3	SMART
FN3	290	366	6.45e-5	SMART
FN3	378	459	5e-2	SMART
FN3	468	546	1.61e-5	SMART
FN3	555	632	7.18e-3	SMART
FN3	644	724	7.52e-6	SMART
FN3	732	811	2.92e-3	SMART
FN3	820	899	2.76e-4	SMART
FN3	908	987	1.29e-4	SMART
FN3	996	1075	7.7e-3	SMART
FN3	1086	1166	1.21e0	SMART
FN3	1174	1253	5.08e-3	SMART
FN3	1262	1340	1.17e-7	SMART
FN3	1356	1435	2.68e-2	SMART
Blast:FN3	1450	1591	6e-88	BLAST
transmembrane domain	1620	1642	N/A	INTRINSIC
Blast:PTPc	1643	1681	3e-11	BLAST
PTPc	1703	1966	1.05e-134	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000218553
AA Change: V2089G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.4%

Validation Efficiency

98% (91/93)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and one intracytoplasmic catalytic domain, thus belongs to receptor type PTP. The extracellular region of this PTP is composed of multiple fibronectin type_III repeats, which was shown to interact with neuronal receptor and cell adhesion molecules, such as contactin and tenascin C. This protein was also found to interact with sodium channels, and thus may regulate sodium channels by altering tyrosine phosphorylation status. The functions of the interaction partners of this protein implicate the roles of this PTP in cell adhesion, neurite growth, and neuronal differentiation. Alternate transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality at E10, impaired vascular maintenace and remodeling, heart defects and abnormal yolk sac vasculature. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430A15Rik	A	T	2: 111,229,222	M64K	possibly damaging	Het
Abcc5	T	C	16: 20,333,729	T1356A	possibly damaging	Het
Ace3	A	G	11: 105,995,875	T154A	probably benign	Het
Arhgap31	C	A	16: 38,602,604	Q1033H	probably damaging	Het
BC067074	A	G	13: 113,351,629	R9G		Het
C1qtnf1	C	T	11: 118,446,514	R57*	probably null	Het
Cacna1g	T	C	11: 94,429,136	T1405A	probably damaging	Het
Cacna1i	A	G	15: 80,375,810		probably benign	Het
Cdca4	T	A	12: 112,822,114		probably null	Het
Cpa4	T	A	6: 30,585,159	M314K	probably damaging	Het
Cpn2	A	T	16: 30,259,267	S539T	possibly damaging	Het
Crebbp	A	G	16: 4,084,458	S2306P	probably damaging	Het
Dcaf5	T	C	12: 80,339,033	H773R	probably benign	Het
Dcun1d2	A	T	8: 13,261,406	D194E	probably benign	Het
Dnah1	G	T	14: 31,267,810	R3250S	possibly damaging	Het
Dnajc25	A	C	4: 59,020,195	K206T	possibly damaging	Het
Dnajc27	T	C	12: 4,096,325	L118P	possibly damaging	Het
Etl4	C	T	2: 20,709,477	T129I	probably damaging	Het
Faap100	A	G	11: 120,372,177	I785T	probably damaging	Het
Fam227b	A	T	2: 125,989,008	D425E	probably benign	Het
Fat4	C	G	3: 39,010,693	L4933V	probably damaging	Het
Fbrsl1	A	G	5: 110,378,220	F39L	probably damaging	Het
Fezf1	A	G	6: 23,247,770	V102A	probably benign	Het
Gabra2	T	C	5: 71,012,697		probably benign	Het
Garnl3	C	A	2: 33,026,094	R346L	probably damaging	Het
Grin2a	A	T	16: 9,585,225	I799N	possibly damaging	Het
Hspa4	A	G	11: 53,269,864	F462L	probably damaging	Het
Iars	C	A	13: 49,703,199		probably benign	Het
Igkv6-32	C	T	6: 70,074,079	V98M	possibly damaging	Het
Il31ra	A	G	13: 112,525,838	F560S	possibly damaging	Het
Itpr3	G	A	17: 27,118,677		probably benign	Het
Kif2a	G	A	13: 106,979,541	T299I	probably damaging	Het
Leo1	T	A	9: 75,466,262	Y656*	probably null	Het
Lpcat2	T	A	8: 92,909,236	V422D	probably damaging	Het
Lrrcc1	T	A	3: 14,536,024	S39T	probably benign	Het
Macf1	A	T	4: 123,512,076	S341T	probably benign	Het
Mc2r	T	A	18: 68,407,808	Y138F	probably damaging	Het
Mepe	A	G	5: 104,337,888	N298S	possibly damaging	Het
Mmp15	C	A	8: 95,366,354	N120K	possibly damaging	Het
Mrps9	A	G	1: 42,879,755	R106G	probably damaging	Het
Muc16	T	A	9: 18,646,448	M2850L	unknown	Het
Mxra8	T	A	4: 155,842,665	I352N	probably damaging	Het
Myo16	G	A	8: 10,361,042	V167I	unknown	Het
Neb	T	C	2: 52,325,039	D209G	probably damaging	Het
Nlgn2	A	G	11: 69,825,483	V744A	probably benign	Het
Notch2	A	G	3: 98,121,902		probably null	Het
Nr1d1	G	C	11: 98,769,247	R484G	probably damaging	Het
Olfr180	G	A	16: 58,916,480	R54C	probably benign	Het
Olfr296-ps1	A	T	7: 86,561,939	H69L	unknown	Het
Olfr826	T	C	10: 130,180,833	I16V	probably benign	Het
Olfr988	T	C	2: 85,353,609	T106A	probably benign	Het
Oxa1l	A	G	14: 54,367,791		probably null	Het
Piwil4	T	C	9: 14,705,026	D15G		Het
Plcz1	C	A	6: 140,003,886	W461L	probably damaging	Het
Plek	A	T	11: 16,994,676	I118N	probably damaging	Het
Poc1b	C	A	10: 99,164,866		probably benign	Het
Ppp1r16b	G	A	2: 158,751,178	D226N	probably damaging	Het
Prss36	T	C	7: 127,933,463	T739A	possibly damaging	Het
Psme2	A	T	14: 55,589,617		probably null	Het
Rabep2	C	A	7: 126,435,676	Y84*	probably null	Het
Rbbp6	T	G	7: 123,001,293	S1508A	unknown	Het
Rel	A	T	11: 23,742,430	D534E	probably benign	Het
Rpgrip1	G	A	14: 52,159,395	S1258N	probably damaging	Het
Rprml	T	C	11: 103,650,127	L116P	probably damaging	Het
Rsph10b	A	G	5: 143,950,294	T323A	possibly damaging	Het
Rtn4rl1	A	G	11: 75,265,273	H177R	probably damaging	Het
Sag	A	G	1: 87,810,310	T24A	probably benign	Het
Scgb2b26	G	T	7: 33,944,359	T52N	probably damaging	Het
Scn10a	T	C	9: 119,672,128	I197V	probably damaging	Het
Sec24c	T	A	14: 20,692,859	V1003D	possibly damaging	Het
Sirt2	G	A	7: 28,771,836	G30E	probably damaging	Het
Slc13a5	T	A	11: 72,259,093	Q197L	probably benign	Het
Slc44a3	A	T	3: 121,490,269	S445T	probably damaging	Het
Slc7a7	A	T	14: 54,372,992	V399E	probably benign	Het
Smarcad1	T	A	6: 65,111,881	D1000E	probably benign	Het
Sorcs2	G	T	5: 36,039,313	Q663K	probably benign	Het
Stat4	A	G	1: 52,079,832	R345G	probably null	Het
Sycp2	G	A	2: 178,350,975	R1261C	probably damaging	Het
Tcf19	T	C	17: 35,514,484	I259V	probably benign	Het
Thada	T	A	17: 84,229,209	R1636S	probably benign	Het
Tnrc6c	T	C	11: 117,714,135	L32P	probably benign	Het
Tonsl	G	A	15: 76,632,876	T881I	probably benign	Het
Tonsl	A	C	15: 76,634,063	C570G	probably damaging	Het
Ube2o	C	A	11: 116,541,447	E898*	probably null	Het
Usp5	T	C	6: 124,817,431	H762R	possibly damaging	Het
Vmn2r15	A	G	5: 109,286,913	S642P	probably benign	Het
Vmn2r23	T	C	6: 123,713,472	W436R	probably damaging	Het
Vps13d	A	C	4: 145,085,407	I3343M		Het
Wbp11	T	C	6: 136,822,934	K83E	probably damaging	Het
Zfp26	T	A	9: 20,444,905	N36Y	possibly damaging	Het
Zfp57	T	A	17: 37,010,046	I264N	probably damaging	Het

Other mutations in Ptprb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01295:Ptprb	APN	10	116362648	missense	probably benign	0.15
IGL01354:Ptprb	APN	10	116343891	missense	probably benign	0.24
IGL01404:Ptprb	APN	10	116339436	missense	probably benign	0.14
IGL01410:Ptprb	APN	10	116302274	missense	possibly damaging	0.60
IGL01412:Ptprb	APN	10	116343915	missense	probably benign	0.27
IGL01731:Ptprb	APN	10	116372876	missense	probably damaging	1.00
IGL02003:Ptprb	APN	10	116367505	missense	probably damaging	1.00
IGL02110:Ptprb	APN	10	116331203	splice site	probably benign
IGL02178:Ptprb	APN	10	116322532	missense	probably benign	0.00
IGL02304:Ptprb	APN	10	116331259	missense	probably damaging	1.00
IGL02324:Ptprb	APN	10	116319333	missense	probably benign	0.03
IGL02388:Ptprb	APN	10	116367521	missense	probably damaging	1.00
IGL02640:Ptprb	APN	10	116338664	missense	probably damaging	0.99
IGL02698:Ptprb	APN	10	116363280	missense	probably benign	0.05
IGL02876:Ptprb	APN	10	116348211	splice site	probably benign
IGL02879:Ptprb	APN	10	116327968	missense	probably benign
IGL02982:Ptprb	APN	10	116322628	missense	probably benign	0.20
IGL03146:Ptprb	APN	10	116328127	missense	probably benign	0.14
IGL03351:Ptprb	APN	10	116339582	missense	probably benign	0.03
R0306:Ptprb	UTSW	10	116343988	missense	probably benign	0.04
R0385:Ptprb	UTSW	10	116350178	missense	probably benign	0.00
R0600:Ptprb	UTSW	10	116368807	missense	possibly damaging	0.63
R0613:Ptprb	UTSW	10	116302325	missense	possibly damaging	0.59
R0613:Ptprb	UTSW	10	116302378	missense	possibly damaging	0.87
R0850:Ptprb	UTSW	10	116302125	missense	possibly damaging	0.87
R0850:Ptprb	UTSW	10	116339510	missense	probably damaging	1.00
R1331:Ptprb	UTSW	10	116367532	missense	probably damaging	1.00
R1413:Ptprb	UTSW	10	116339679	missense	probably damaging	1.00
R1418:Ptprb	UTSW	10	116319470	missense	probably benign	0.00
R1545:Ptprb	UTSW	10	116380869	missense	probably damaging	1.00
R1562:Ptprb	UTSW	10	116339467	missense	probably benign	0.00
R1752:Ptprb	UTSW	10	116340990	missense	probably benign	0.44
R1837:Ptprb	UTSW	10	116341626	missense	probably benign	0.00
R1940:Ptprb	UTSW	10	116319610	splice site	probably benign
R1958:Ptprb	UTSW	10	116341536	missense	probably benign	0.10
R2029:Ptprb	UTSW	10	116347053	missense	probably benign	0.37
R2031:Ptprb	UTSW	10	116317543	missense	probably benign
R2101:Ptprb	UTSW	10	116315038	splice site	probably benign
R2209:Ptprb	UTSW	10	116369357	missense	probably damaging	1.00
R3016:Ptprb	UTSW	10	116357295	missense	possibly damaging	0.64
R3076:Ptprb	UTSW	10	116344026	missense	probably damaging	0.99
R3821:Ptprb	UTSW	10	116350074	missense	probably benign	0.11
R3824:Ptprb	UTSW	10	116350789	missense	probably benign	0.05
R3825:Ptprb	UTSW	10	116350789	missense	probably benign	0.05
R3841:Ptprb	UTSW	10	116346982	missense	possibly damaging	0.79
R3953:Ptprb	UTSW	10	116341494	missense	probably benign	0.00
R4125:Ptprb	UTSW	10	116353849	missense	probably benign	0.12
R4227:Ptprb	UTSW	10	116302225	missense	possibly damaging	0.96
R4385:Ptprb	UTSW	10	116346867	missense	probably benign
R4731:Ptprb	UTSW	10	116319333	missense	probably benign	0.03
R5009:Ptprb	UTSW	10	116348127	missense	possibly damaging	0.61
R5104:Ptprb	UTSW	10	116322459	missense	probably benign	0.17
R5114:Ptprb	UTSW	10	116348183	missense	possibly damaging	0.59
R5145:Ptprb	UTSW	10	116343915	missense	probably benign	0.27
R5214:Ptprb	UTSW	10	116369324	missense	possibly damaging	0.75
R5382:Ptprb	UTSW	10	116353871	missense	probably damaging	1.00
R5553:Ptprb	UTSW	10	116350185	missense	probably damaging	1.00
R5585:Ptprb	UTSW	10	116380854	missense	probably damaging	0.98
R5586:Ptprb	UTSW	10	116353827	missense	probably damaging	1.00
R5808:Ptprb	UTSW	10	116339487	missense	probably benign	0.00
R5875:Ptprb	UTSW	10	116348166	missense	probably benign	0.00
R6051:Ptprb	UTSW	10	116341090	nonsense	probably null
R6383:Ptprb	UTSW	10	116347007	nonsense	probably null
R6511:Ptprb	UTSW	10	116346820	missense	probably damaging	1.00
R6817:Ptprb	UTSW	10	116283677	small deletion	probably benign
R6826:Ptprb	UTSW	10	116317372	missense	probably benign	0.26
R6958:Ptprb	UTSW	10	116277248	missense	probably benign	0.32
R7103:Ptprb	UTSW	10	116338813	missense	probably damaging	1.00
R7129:Ptprb	UTSW	10	116283677	small deletion	probably benign
R7181:Ptprb	UTSW	10	116368766	missense	probably damaging	1.00
R7215:Ptprb	UTSW	10	116338776	missense	possibly damaging	0.94
R7289:Ptprb	UTSW	10	116328165	missense	probably damaging	0.99
R7315:Ptprb	UTSW	10	116362379	missense	possibly damaging	0.83
R7319:Ptprb	UTSW	10	116341404	missense	probably benign	0.01
R7381:Ptprb	UTSW	10	116341133	missense	probably benign
R7412:Ptprb	UTSW	10	116341138	missense	probably benign
R7483:Ptprb	UTSW	10	116283429	missense	probably benign	0.01
R7495:Ptprb	UTSW	10	116341448	missense	probably benign	0.12
R7508:Ptprb	UTSW	10	116353991	nonsense	probably null
R7571:Ptprb	UTSW	10	116339430	missense	probably damaging	1.00
R7586:Ptprb	UTSW	10	116343874	missense	probably damaging	0.97
R7623:Ptprb	UTSW	10	116369309	missense	possibly damaging	0.63
R7694:Ptprb	UTSW	10	116372948	missense	probably damaging	1.00
R7744:Ptprb	UTSW	10	116277484	missense	probably benign	0.10
R7752:Ptprb	UTSW	10	116369428	missense	probably benign	0.37
R7826:Ptprb	UTSW	10	116283677	small deletion	probably benign
R7833:Ptprb	UTSW	10	116315251	missense	probably benign	0.01
R7834:Ptprb	UTSW	10	116339424	missense	probably benign	0.00
R7846:Ptprb	UTSW	10	116283548	missense	probably benign	0.17
R7896:Ptprb	UTSW	10	116369457	splice site	probably null
R7901:Ptprb	UTSW	10	116369428	missense	probably benign	0.37
R7912:Ptprb	UTSW	10	116322487	missense	probably damaging	1.00
R7941:Ptprb	UTSW	10	116283677	small deletion	probably benign
R8147:Ptprb	UTSW	10	116317378	missense	probably damaging	1.00
R8202:Ptprb	UTSW	10	116353845	missense	probably damaging	1.00
R8339:Ptprb	UTSW	10	116283451	missense	probably benign	0.14
R8400:Ptprb	UTSW	10	116283572	small deletion	probably benign
R8504:Ptprb	UTSW	10	116341031	missense	probably benign	0.27
R8786:Ptprb	UTSW	10	116319401	missense	probably benign	0.40
R8914:Ptprb	UTSW	10	116322662	nonsense	probably null
R8980:Ptprb	UTSW	10	116283621	missense	probably benign	0.07
R8982:Ptprb	UTSW	10	116283677	small deletion	probably benign
R9256:Ptprb	UTSW	10	116383871	missense	probably damaging	1.00
R9288:Ptprb	UTSW	10	116319448	missense	probably benign	0.03
R9369:Ptprb	UTSW	10	116315152	missense	probably benign	0.00
RF041:Ptprb	UTSW	10	116283677	small deletion	probably benign
X0020:Ptprb	UTSW	10	116302180	missense	possibly damaging	0.62
Z1176:Ptprb	UTSW	10	116302156	frame shift	probably null
Z1177:Ptprb	UTSW	10	116362642	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GCCGAGACCTCCATATCATC -3'
(R):5'- GGGAGACAGTCTGGAAATCCAC -3'

Sequencing Primer
(F):5'- GCCGAGACCTCCATATCATCTAATC -3'
(R):5'- GACAGTCTGGAAATCCACTACATAC -3'

Posted On

2021-03-08