Incidental Mutation 'R8680:Tln1'
ID661657
Institutional Source Beutler Lab
Gene Symbol Tln1
Ensembl Gene ENSMUSG00000028465
Gene Nametalin 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8680 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location43531519-43562691 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43553041 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 350 (E350G)
Ref Sequence ENSEMBL: ENSMUSP00000030187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030187] [ENSMUST00000130353]
PDB Structure Crystal Structure of Talin Rod 482-655 [X-RAY DIFFRACTION]
Crystal Structure of talin residues 482-789 [X-RAY DIFFRACTION]
Vinculin complexed with the VBS1 helix from talin [X-RAY DIFFRACTION]
Solution structure of VBS2 fragment of talin [SOLUTION NMR]
Structural basis for phosphatidylinositol phosphate kinase type I-gamma binding to talin at focal adhesions [X-RAY DIFFRACTION]
Vinculin Head (0-258) in Complex with the Talin Rod residues 1630-1652 [X-RAY DIFFRACTION]
Solution structure of VBS3 fragment of talin [SOLUTION NMR]
NMR structure of talin-PTB in complex with PIPKI [SOLUTION NMR]
NMR structure of the talin C-terminal actin binding site [SOLUTION NMR]
NMR structure of the talin rod domain, 1655-1822 [SOLUTION NMR]
>> 16 additional structures at PDB <<
Predicted Effect possibly damaging
Transcript: ENSMUST00000030187
AA Change: E350G

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000030187
Gene: ENSMUSG00000028465
AA Change: E350G

DomainStartEndE-ValueType
Blast:B41 2 76 5e-31 BLAST
B41 82 313 4.66e-73 SMART
IRS 308 401 7.65e-16 SMART
Pfam:Talin_middle 491 652 8.2e-60 PFAM
low complexity region 671 690 N/A INTRINSIC
internal_repeat_2 699 760 8.94e-6 PROSPERO
low complexity region 766 775 N/A INTRINSIC
PDB:1ZVZ|B 820 844 2e-7 PDB
low complexity region 866 879 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
PDB:2LQG|A 913 1044 2e-44 PDB
PDB:2L7N|A 1046 1207 1e-101 PDB
Pfam:VBS 1234 1358 9.6e-8 PFAM
internal_repeat_2 1488 1549 8.94e-6 PROSPERO
internal_repeat_3 1623 1769 4.92e-5 PROSPERO
low complexity region 1817 1828 N/A INTRINSIC
Pfam:VBS 1849 1973 6.2e-67 PFAM
PDB:3DYJ|B 1974 2293 N/A PDB
low complexity region 2305 2327 N/A INTRINSIC
ILWEQ 2336 2533 2.93e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125509
SMART Domains Protein: ENSMUSP00000115681
Gene: ENSMUSG00000028465

DomainStartEndE-ValueType
Blast:IRS 2 28 2e-9 BLAST
PDB:2G35|A 2 29 3e-11 PDB
Pfam:Talin_middle 32 193 1.8e-61 PFAM
PDB:2L7A|A 215 279 1e-38 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000130353
SMART Domains Protein: ENSMUSP00000119441
Gene: ENSMUSG00000028465

DomainStartEndE-ValueType
Blast:B41 1 39 9e-7 BLAST
B41 82 241 6.58e-9 SMART
Meta Mutation Damage Score 0.2428 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.6%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is concentrated in areas of cell-substratum and cell-cell contacts. The encoded protein plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. It codistributes with integrins in the cell surface membrane in order to assist in the attachment of adherent cells to extracellular matrices and of lymphocytes to other cells. The N-terminus of this protein contains elements for localization to cell-extracellular matrix junctions. The C-terminus contains binding sites for proteins such as beta-1-integrin, actin, and vinculin. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for either one of two knock-out alleles display early developmental anomalies, reduced embryo size, and embryonic lethality due to impaired cell migration at the gastrulation stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik T C 16: 91,055,663 Y195C probably damaging Het
Abcb1a T A 5: 8,685,371 F159L probably damaging Het
Adam6b A G 12: 113,490,751 N396S probably benign Het
Adamts15 T C 9: 30,911,759 M338V possibly damaging Het
Adamts7 T A 9: 90,195,268 H1329Q probably damaging Het
Aim2 C T 1: 173,462,220 P243L probably damaging Het
Ankdd1a T C 9: 65,505,136 D311G probably damaging Het
Apon A T 10: 128,254,559 E35D probably benign Het
Atp1a4 T C 1: 172,250,999 D224G probably damaging Het
Atp6v0a1 T A 11: 101,062,403 *839R probably null Het
Bco2 A G 9: 50,550,578 L42P probably damaging Het
Bicral T A 17: 46,830,947 probably benign Het
Casc1 T A 6: 145,181,816 I456F probably benign Het
Ccna1 T C 3: 55,048,457 Q306R probably benign Het
Cep152 G T 2: 125,564,211 S1467* probably null Het
Cfap44 T A 16: 44,404,722 V110E probably damaging Het
Clip2 G A 5: 134,502,608 A781V probably benign Het
Cps1 A T 1: 67,204,613 I1083F probably damaging Het
Cux1 A G 5: 136,307,856 V934A possibly damaging Het
Depdc5 T C 5: 32,944,038 F891L possibly damaging Het
Dnajc13 A G 9: 104,180,139 V1554A probably benign Het
Echs1 A T 7: 140,110,586 M191K probably damaging Het
Eif6 T A 2: 155,822,852 D238V probably benign Het
Fam71d TGATGTCACAGATGTCAC TGATGTCAC 12: 78,715,283 probably benign Het
Fat2 G A 11: 55,253,866 L4061F probably benign Het
Fat3 T C 9: 15,997,407 D2433G probably damaging Het
Flt3 A G 5: 147,383,455 V33A probably benign Het
Gpr155 T C 2: 73,343,695 E790G probably damaging Het
Ighv1-67 A T 12: 115,604,241 V17E probably damaging Het
Klra9 T A 6: 130,188,676 R125S probably damaging Het
Leo1 T C 9: 75,445,995 probably null Het
Map2 G T 1: 66,421,713 R1556L probably damaging Het
Megf8 A G 7: 25,359,741 probably null Het
Meikin T C 11: 54,426,651 I426T possibly damaging Het
Muc16 A T 9: 18,644,719 V3426E unknown Het
Olfr1061 T C 2: 86,413,591 I154V probably benign Het
Olfr12 T C 1: 92,619,921 V5A probably benign Het
Olfr1234 T A 2: 89,362,721 Y236F probably benign Het
Olfr609 G A 7: 103,492,822 L19F probably damaging Het
Olfr668 A G 7: 104,925,413 L117P probably damaging Het
Olfr859 T G 9: 19,808,809 S164A possibly damaging Het
Otogl A G 10: 107,912,075 probably null Het
Palm3 T C 8: 84,029,875 L672P probably damaging Het
Perm1 A G 4: 156,217,634 T212A probably benign Het
Poc1a T C 9: 106,349,761 M400T probably benign Het
Pou6f2 T A 13: 18,239,611 Q193L unknown Het
Ppl C T 16: 5,087,436 R1665H probably benign Het
Ppp4r3b T C 11: 29,173,449 probably null Het
Ptger1 T C 8: 83,668,025 S44P probably damaging Het
Pzp T C 6: 128,496,046 T787A probably benign Het
Rab44 A T 17: 29,139,668 R277* probably null Het
Rasgef1a T A 6: 118,087,127 I334K probably damaging Het
Rfx1 T C 8: 84,091,455 V554A possibly damaging Het
Ripk1 T A 13: 34,030,049 I518K possibly damaging Het
Rpl22 A G 4: 152,332,306 Y90C probably damaging Het
Rps27a C A 11: 29,545,998 R118L probably benign Het
Scmh1 T A 4: 120,462,134 S19T probably benign Het
Scn10a C T 9: 119,691,443 probably null Het
Sema4c A T 1: 36,550,786 S496T probably benign Het
Serpina3i T C 12: 104,265,128 V8A possibly damaging Het
Sis G A 3: 72,960,295 T139M probably damaging Het
Slc45a2 T A 15: 11,000,886 S24T probably benign Het
Slc5a11 A G 7: 123,267,752 I423M probably benign Het
Slc7a10 G A 7: 35,186,572 G31S probably benign Het
Sowahc A G 10: 59,223,179 N379S probably benign Het
Stat5a T C 11: 100,883,888 M741T unknown Het
Tcf15 T C 2: 152,144,100 S159P probably benign Het
Tdrd5 C A 1: 156,271,218 R669L possibly damaging Het
Trim12c T G 7: 104,348,064 N95T Het
Ttc37 A T 13: 76,155,468 H1227L probably benign Het
Urb1 T C 16: 90,774,625 T1099A probably benign Het
Vmn1r44 T A 6: 89,893,596 V108D probably damaging Het
Vmn2r65 A G 7: 84,940,180 Y843H probably benign Het
Vmn2r68 A G 7: 85,222,113 I654T possibly damaging Het
Vps13a T C 19: 16,645,906 N2797S possibly damaging Het
Wscd2 T C 5: 113,574,174 Y385H probably damaging Het
Xdh T C 17: 73,922,505 I318V probably benign Het
Xrcc3 T A 12: 111,807,879 K172M probably damaging Het
Other mutations in Tln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Tln1 APN 4 43542719 missense probably benign 0.22
IGL00987:Tln1 APN 4 43551297 unclassified probably benign
IGL01345:Tln1 APN 4 43536281 missense probably damaging 1.00
IGL01456:Tln1 APN 4 43543432 unclassified probably benign
IGL01715:Tln1 APN 4 43555890 missense probably damaging 1.00
IGL01750:Tln1 APN 4 43545435 missense probably damaging 1.00
IGL01933:Tln1 APN 4 43539508 missense probably benign
IGL01933:Tln1 APN 4 43555894 missense possibly damaging 0.52
IGL02119:Tln1 APN 4 43546760 missense probably damaging 0.99
IGL02148:Tln1 APN 4 43555388 missense probably damaging 1.00
IGL02153:Tln1 APN 4 43546857 missense possibly damaging 0.76
IGL02522:Tln1 APN 4 43540612 missense probably benign 0.07
IGL02691:Tln1 APN 4 43539544 missense probably benign 0.42
IGL02882:Tln1 APN 4 43539522 missense probably benign 0.45
IGL02892:Tln1 APN 4 43555679 missense probably damaging 1.00
IGL03061:Tln1 APN 4 43545694 missense probably damaging 1.00
IGL03102:Tln1 APN 4 43532861 missense possibly damaging 0.89
IGL03183:Tln1 APN 4 43539084 splice site probably benign
H8786:Tln1 UTSW 4 43544589 missense probably damaging 0.97
PIT4576001:Tln1 UTSW 4 43539998 missense probably damaging 1.00
PIT4696001:Tln1 UTSW 4 43542701 critical splice donor site probably null
R0206:Tln1 UTSW 4 43549151 missense probably damaging 1.00
R0208:Tln1 UTSW 4 43549151 missense probably damaging 1.00
R0454:Tln1 UTSW 4 43553504 missense probably benign
R0539:Tln1 UTSW 4 43543434 critical splice donor site probably null
R0548:Tln1 UTSW 4 43542709 missense possibly damaging 0.79
R0561:Tln1 UTSW 4 43550304 missense possibly damaging 0.94
R0606:Tln1 UTSW 4 43547756 missense probably benign 0.34
R0607:Tln1 UTSW 4 43553071 missense probably damaging 1.00
R0609:Tln1 UTSW 4 43544645 missense possibly damaging 0.63
R0847:Tln1 UTSW 4 43555333 missense probably damaging 1.00
R0993:Tln1 UTSW 4 43549825 missense probably benign 0.22
R1255:Tln1 UTSW 4 43538044 missense probably damaging 1.00
R1292:Tln1 UTSW 4 43534578 critical splice donor site probably null
R1752:Tln1 UTSW 4 43536311 missense probably damaging 1.00
R2169:Tln1 UTSW 4 43548005 missense probably damaging 1.00
R2172:Tln1 UTSW 4 43545721 missense probably benign
R2202:Tln1 UTSW 4 43553083 splice site probably null
R2680:Tln1 UTSW 4 43539668 missense probably damaging 1.00
R3012:Tln1 UTSW 4 43542525 missense probably benign
R3714:Tln1 UTSW 4 43540597 missense probably damaging 1.00
R3735:Tln1 UTSW 4 43549370 missense probably damaging 0.97
R3794:Tln1 UTSW 4 43536295 missense probably damaging 1.00
R3825:Tln1 UTSW 4 43536413 splice site probably benign
R3983:Tln1 UTSW 4 43553030 missense probably damaging 1.00
R4061:Tln1 UTSW 4 43549177 missense probably damaging 1.00
R4249:Tln1 UTSW 4 43536104 missense probably damaging 1.00
R4287:Tln1 UTSW 4 43543509 missense probably benign 0.01
R4471:Tln1 UTSW 4 43551018 missense probably benign 0.03
R4562:Tln1 UTSW 4 43533598 missense probably damaging 1.00
R4654:Tln1 UTSW 4 43535954 missense probably null 1.00
R4737:Tln1 UTSW 4 43540588 missense probably benign 0.00
R4936:Tln1 UTSW 4 43547522 missense possibly damaging 0.83
R5225:Tln1 UTSW 4 43539406 missense probably benign 0.06
R5288:Tln1 UTSW 4 43540661 missense probably benign 0.06
R5421:Tln1 UTSW 4 43533609 missense possibly damaging 0.80
R5445:Tln1 UTSW 4 43543905 missense probably benign 0.26
R5660:Tln1 UTSW 4 43547732 missense probably damaging 1.00
R5772:Tln1 UTSW 4 43545191 missense probably benign 0.13
R6012:Tln1 UTSW 4 43539508 missense probably benign
R6038:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6038:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6039:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6039:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6052:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6145:Tln1 UTSW 4 43538030 missense possibly damaging 0.64
R6157:Tln1 UTSW 4 43534744 missense probably benign 0.06
R6242:Tln1 UTSW 4 43533145 missense probably damaging 1.00
R6454:Tln1 UTSW 4 43533866 missense probably damaging 0.99
R6467:Tln1 UTSW 4 43543165 missense probably benign 0.42
R6548:Tln1 UTSW 4 43547525 missense probably damaging 0.98
R6576:Tln1 UTSW 4 43555419 splice site probably null
R6722:Tln1 UTSW 4 43547618 missense probably damaging 1.00
R6968:Tln1 UTSW 4 43550217 missense probably benign 0.02
R7000:Tln1 UTSW 4 43556302 missense probably damaging 0.96
R7137:Tln1 UTSW 4 43540616 missense probably damaging 1.00
R7242:Tln1 UTSW 4 43542602 missense probably benign 0.01
R7294:Tln1 UTSW 4 43534399 missense probably benign 0.02
R7312:Tln1 UTSW 4 43545922 missense probably damaging 1.00
R7547:Tln1 UTSW 4 43545206 missense possibly damaging 0.80
R7836:Tln1 UTSW 4 43554309 missense probably benign 0.01
R7874:Tln1 UTSW 4 43538041 missense probably damaging 1.00
R7874:Tln1 UTSW 4 43555606 missense probably damaging 1.00
R8030:Tln1 UTSW 4 43535737 critical splice donor site probably null
R8105:Tln1 UTSW 4 43538231 missense probably benign 0.32
R8212:Tln1 UTSW 4 43555918 missense probably damaging 1.00
R8416:Tln1 UTSW 4 43540116 missense probably benign 0.01
R8419:Tln1 UTSW 4 43536397 missense probably damaging 1.00
R8725:Tln1 UTSW 4 43555911 missense possibly damaging 0.94
R8727:Tln1 UTSW 4 43555911 missense possibly damaging 0.94
R8830:Tln1 UTSW 4 43556383 missense probably benign
R8865:Tln1 UTSW 4 43538281 missense possibly damaging 0.93
RF021:Tln1 UTSW 4 43555890 missense probably damaging 1.00
X0052:Tln1 UTSW 4 43533125 critical splice donor site probably null
X0063:Tln1 UTSW 4 43548015 nonsense probably null
Z1176:Tln1 UTSW 4 43543211 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- CTGTAAGAACGTCTCCATCTCC -3'
(R):5'- CAGTTGTTTAGCCCTCCTGG -3'

Sequencing Primer
(F):5'- GTAAGAACGTCTCCATCTCCTCTAAC -3'
(R):5'- TCCCCTTGTGGTCCAGAG -3'
Posted On2021-03-08