Incidental Mutation 'R8680:Depdc5'
ID 661662
Institutional Source Beutler Lab
Gene Symbol Depdc5
Ensembl Gene ENSMUSG00000037426
Gene Name DEP domain containing 5
Synonyms
MMRRC Submission 068535-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8680 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 33021045-33151580 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 33101382 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 891 (F891L)
Ref Sequence ENSEMBL: ENSMUSP00000113862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049780] [ENSMUST00000087897] [ENSMUST00000119705] [ENSMUST00000120902] [ENSMUST00000124780] [ENSMUST00000130461]
AlphaFold P61460
Predicted Effect probably benign
Transcript: ENSMUST00000049780
AA Change: F891L

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000052807
Gene: ENSMUSG00000037426
AA Change: F891L

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3.7e-64 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000087897
AA Change: F900L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000085207
Gene: ENSMUSG00000037426
AA Change: F900L

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 2.3e-63 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 826 836 N/A INTRINSIC
low complexity region 994 1006 N/A INTRINSIC
low complexity region 1159 1175 N/A INTRINSIC
DEP 1184 1259 2.49e-15 SMART
low complexity region 1322 1335 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000119705
AA Change: F891L

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113862
Gene: ENSMUSG00000037426
AA Change: F891L

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3e-117 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1150 1166 N/A INTRINSIC
DEP 1175 1250 2.49e-15 SMART
low complexity region 1313 1326 N/A INTRINSIC
low complexity region 1511 1525 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000120902
AA Change: F891L

PolyPhen 2 Score 0.746 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113980
Gene: ENSMUSG00000037426
AA Change: F891L

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3.7e-63 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1128 1144 N/A INTRINSIC
DEP 1153 1228 2.49e-15 SMART
low complexity region 1291 1304 N/A INTRINSIC
low complexity region 1489 1503 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124780
AA Change: F253L

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000120120
Gene: ENSMUSG00000037426
AA Change: F253L

DomainStartEndE-ValueType
low complexity region 179 189 N/A INTRINSIC
low complexity region 347 359 N/A INTRINSIC
SCOP:d1fsha_ 519 586 1e-13 SMART
Blast:DEP 537 589 2e-24 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000130461
SMART Domains Protein: ENSMUSP00000118681
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
low complexity region 70 82 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000121089
Gene: ENSMUSG00000037426
AA Change: F297L

DomainStartEndE-ValueType
low complexity region 54 65 N/A INTRINSIC
low complexity region 88 97 N/A INTRINSIC
low complexity region 224 234 N/A INTRINSIC
low complexity region 392 404 N/A INTRINSIC
low complexity region 535 551 N/A INTRINSIC
DEP 560 635 2.49e-15 SMART
low complexity region 698 711 N/A INTRINSIC
low complexity region 896 910 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.6%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IML1 family of proteins involved in G-protein signaling pathways. The mechanistic target of rapamycin complex 1 (mTORC1) pathway regulates cell growth by sensing the availability of nutrients. The protein encoded by this gene is a component of the GATOR1 (GAP activity toward Rags) complex which inhibits the amino acid-sensing branch of the mTORC1 pathway. Mutations in this gene are associated with autosomal dominant familial focal epilepsy with variable foci. A single nucleotide polymorphism in an intron of this gene has been associated with an increased risk of hepatocellular carcinoma in individuals with chronic hepatitis C virus infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for a conditional allele activated in neurons exhibit reduced body weight, limb grasping, premature death, spontaneous seizure, increased brain size due to neuron hypertrophy and increased PTZ seizure susceptibility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik T C 16: 90,852,551 (GRCm39) Y195C probably damaging Het
Abcb1a T A 5: 8,735,371 (GRCm39) F159L probably damaging Het
Adam6b A G 12: 113,454,371 (GRCm39) N396S probably benign Het
Adamts15 T C 9: 30,823,055 (GRCm39) M338V possibly damaging Het
Adamts7 T A 9: 90,077,321 (GRCm39) H1329Q probably damaging Het
Aim2 C T 1: 173,289,786 (GRCm39) P243L probably damaging Het
Ankdd1a T C 9: 65,412,418 (GRCm39) D311G probably damaging Het
Apon A T 10: 128,090,428 (GRCm39) E35D probably benign Het
Atp1a4 T C 1: 172,078,566 (GRCm39) D224G probably damaging Het
Atp6v0a1 T A 11: 100,953,229 (GRCm39) *839R probably null Het
Bco2 A G 9: 50,461,878 (GRCm39) L42P probably damaging Het
Bicral T A 17: 47,141,873 (GRCm39) probably benign Het
Ccna1 T C 3: 54,955,878 (GRCm39) Q306R probably benign Het
Cep152 G T 2: 125,406,131 (GRCm39) S1467* probably null Het
Cfap44 T A 16: 44,225,085 (GRCm39) V110E probably damaging Het
Clip2 G A 5: 134,531,462 (GRCm39) A781V probably benign Het
Cps1 A T 1: 67,243,772 (GRCm39) I1083F probably damaging Het
Cux1 A G 5: 136,336,710 (GRCm39) V934A possibly damaging Het
Dnai7 T A 6: 145,127,542 (GRCm39) I456F probably benign Het
Dnajc13 A G 9: 104,057,338 (GRCm39) V1554A probably benign Het
Echs1 A T 7: 139,690,499 (GRCm39) M191K probably damaging Het
Eif6 T A 2: 155,664,772 (GRCm39) D238V probably benign Het
Fat2 G A 11: 55,144,692 (GRCm39) L4061F probably benign Het
Fat3 T C 9: 15,908,703 (GRCm39) D2433G probably damaging Het
Flt3 A G 5: 147,320,265 (GRCm39) V33A probably benign Het
Garin2 TGATGTCACAGATGTCAC TGATGTCAC 12: 78,762,057 (GRCm39) probably benign Het
Gpr155 T C 2: 73,174,039 (GRCm39) E790G probably damaging Het
Ighv1-67 A T 12: 115,567,861 (GRCm39) V17E probably damaging Het
Klra9 T A 6: 130,165,639 (GRCm39) R125S probably damaging Het
Leo1 T C 9: 75,353,277 (GRCm39) probably null Het
Map2 G T 1: 66,460,872 (GRCm39) R1556L probably damaging Het
Megf8 A G 7: 25,059,166 (GRCm39) probably null Het
Meikin T C 11: 54,317,477 (GRCm39) I426T possibly damaging Het
Muc16 A T 9: 18,556,015 (GRCm39) V3426E unknown Het
Or4a15 T A 2: 89,193,065 (GRCm39) Y236F probably benign Het
Or51af1 G A 7: 103,142,029 (GRCm39) L19F probably damaging Het
Or52n2c A G 7: 104,574,620 (GRCm39) L117P probably damaging Het
Or7e168 T G 9: 19,720,105 (GRCm39) S164A possibly damaging Het
Or8k25 T C 2: 86,243,935 (GRCm39) I154V probably benign Het
Or9s13 T C 1: 92,547,643 (GRCm39) V5A probably benign Het
Otogl A G 10: 107,747,936 (GRCm39) probably null Het
Palm3 T C 8: 84,756,504 (GRCm39) L672P probably damaging Het
Perm1 A G 4: 156,302,091 (GRCm39) T212A probably benign Het
Poc1a T C 9: 106,226,960 (GRCm39) M400T probably benign Het
Pou6f2 T A 13: 18,414,196 (GRCm39) Q193L unknown Het
Ppl C T 16: 4,905,300 (GRCm39) R1665H probably benign Het
Ppp4r3b T C 11: 29,123,449 (GRCm39) probably null Het
Ptger1 T C 8: 84,394,654 (GRCm39) S44P probably damaging Het
Pzp T C 6: 128,473,009 (GRCm39) T787A probably benign Het
Rab44 A T 17: 29,358,642 (GRCm39) R277* probably null Het
Rasgef1a T A 6: 118,064,088 (GRCm39) I334K probably damaging Het
Rfx1 T C 8: 84,818,084 (GRCm39) V554A possibly damaging Het
Ripk1 T A 13: 34,214,032 (GRCm39) I518K possibly damaging Het
Rpl22 A G 4: 152,416,763 (GRCm39) Y90C probably damaging Het
Rps27a C A 11: 29,495,998 (GRCm39) R118L probably benign Het
Scmh1 T A 4: 120,319,331 (GRCm39) S19T probably benign Het
Scn10a C T 9: 119,520,509 (GRCm39) probably null Het
Sema4c A T 1: 36,589,867 (GRCm39) S496T probably benign Het
Serpina3i T C 12: 104,231,387 (GRCm39) V8A possibly damaging Het
Sis G A 3: 72,867,628 (GRCm39) T139M probably damaging Het
Skic3 A T 13: 76,303,587 (GRCm39) H1227L probably benign Het
Slc45a2 T A 15: 11,000,972 (GRCm39) S24T probably benign Het
Slc5a11 A G 7: 122,866,975 (GRCm39) I423M probably benign Het
Slc7a10 G A 7: 34,885,997 (GRCm39) G31S probably benign Het
Sowahc A G 10: 59,059,001 (GRCm39) N379S probably benign Het
Stat5a T C 11: 100,774,714 (GRCm39) M741T unknown Het
Tcf15 T C 2: 151,986,020 (GRCm39) S159P probably benign Het
Tdrd5 C A 1: 156,098,788 (GRCm39) R669L possibly damaging Het
Tln1 T C 4: 43,553,041 (GRCm39) E350G possibly damaging Het
Trim12c T G 7: 103,997,271 (GRCm39) N95T Het
Urb1 T C 16: 90,571,513 (GRCm39) T1099A probably benign Het
Vmn1r44 T A 6: 89,870,578 (GRCm39) V108D probably damaging Het
Vmn2r65 A G 7: 84,589,388 (GRCm39) Y843H probably benign Het
Vmn2r68 A G 7: 84,871,321 (GRCm39) I654T possibly damaging Het
Vps13a T C 19: 16,623,270 (GRCm39) N2797S possibly damaging Het
Wscd2 T C 5: 113,712,235 (GRCm39) Y385H probably damaging Het
Xdh T C 17: 74,229,500 (GRCm39) I318V probably benign Het
Xrcc3 T A 12: 111,774,313 (GRCm39) K172M probably damaging Het
Other mutations in Depdc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Depdc5 APN 5 33,125,158 (GRCm39) splice site probably null
IGL01019:Depdc5 APN 5 33,050,745 (GRCm39) missense probably damaging 0.96
IGL01067:Depdc5 APN 5 33,056,411 (GRCm39) splice site probably null
IGL01405:Depdc5 APN 5 33,095,033 (GRCm39) missense possibly damaging 0.90
IGL01577:Depdc5 APN 5 33,113,241 (GRCm39) missense possibly damaging 0.49
IGL01633:Depdc5 APN 5 33,081,544 (GRCm39) missense probably damaging 1.00
IGL01998:Depdc5 APN 5 33,102,495 (GRCm39) splice site probably benign
IGL02025:Depdc5 APN 5 33,103,976 (GRCm39) critical splice acceptor site probably null
IGL02167:Depdc5 APN 5 33,061,145 (GRCm39) missense probably damaging 1.00
IGL02537:Depdc5 APN 5 33,125,131 (GRCm39) missense probably damaging 1.00
IGL02812:Depdc5 APN 5 33,050,712 (GRCm39) splice site probably benign
IGL03001:Depdc5 APN 5 33,102,434 (GRCm39) missense possibly damaging 0.74
IGL03253:Depdc5 APN 5 33,026,157 (GRCm39) unclassified probably benign
alligator UTSW 5 33,121,851 (GRCm39) splice site probably null
lagarto UTSW 5 33,136,852 (GRCm39) missense probably damaging 1.00
sauros UTSW 5 33,144,310 (GRCm39) missense possibly damaging 0.92
IGL02988:Depdc5 UTSW 5 33,113,511 (GRCm39) splice site probably null
R0038:Depdc5 UTSW 5 33,026,197 (GRCm39) missense probably benign 0.01
R0038:Depdc5 UTSW 5 33,026,197 (GRCm39) missense probably benign 0.01
R0153:Depdc5 UTSW 5 33,091,281 (GRCm39) splice site probably benign
R0179:Depdc5 UTSW 5 33,058,918 (GRCm39) unclassified probably benign
R0212:Depdc5 UTSW 5 33,069,586 (GRCm39) missense probably benign 0.00
R0239:Depdc5 UTSW 5 33,100,584 (GRCm39) missense probably damaging 1.00
R0239:Depdc5 UTSW 5 33,100,584 (GRCm39) missense probably damaging 1.00
R0302:Depdc5 UTSW 5 33,061,890 (GRCm39) critical splice donor site probably benign
R0511:Depdc5 UTSW 5 33,102,372 (GRCm39) nonsense probably null
R0677:Depdc5 UTSW 5 33,058,814 (GRCm39) missense probably damaging 1.00
R0884:Depdc5 UTSW 5 33,075,322 (GRCm39) missense possibly damaging 0.94
R0973:Depdc5 UTSW 5 33,144,310 (GRCm39) missense possibly damaging 0.92
R1314:Depdc5 UTSW 5 33,034,418 (GRCm39) missense probably damaging 1.00
R1611:Depdc5 UTSW 5 33,148,297 (GRCm39) missense probably damaging 1.00
R1687:Depdc5 UTSW 5 33,067,751 (GRCm39) critical splice acceptor site probably benign
R1748:Depdc5 UTSW 5 33,075,286 (GRCm39) missense probably benign 0.24
R1903:Depdc5 UTSW 5 33,067,751 (GRCm39) critical splice acceptor site probably benign
R1956:Depdc5 UTSW 5 33,061,175 (GRCm39) missense probably damaging 1.00
R1997:Depdc5 UTSW 5 33,059,250 (GRCm39) critical splice donor site probably null
R2079:Depdc5 UTSW 5 33,104,018 (GRCm39) missense possibly damaging 0.75
R2131:Depdc5 UTSW 5 33,148,125 (GRCm39) nonsense probably null
R2291:Depdc5 UTSW 5 33,136,746 (GRCm39) missense probably damaging 1.00
R2422:Depdc5 UTSW 5 33,148,379 (GRCm39) missense probably damaging 1.00
R2851:Depdc5 UTSW 5 33,081,515 (GRCm39) missense probably damaging 0.96
R2852:Depdc5 UTSW 5 33,081,515 (GRCm39) missense probably damaging 0.96
R2937:Depdc5 UTSW 5 33,058,965 (GRCm39) splice site probably null
R2938:Depdc5 UTSW 5 33,058,965 (GRCm39) splice site probably null
R2974:Depdc5 UTSW 5 33,091,361 (GRCm39) critical splice donor site probably null
R3884:Depdc5 UTSW 5 33,101,421 (GRCm39) missense probably damaging 1.00
R3967:Depdc5 UTSW 5 33,101,459 (GRCm39) nonsense probably null
R4118:Depdc5 UTSW 5 33,121,979 (GRCm39) missense probably damaging 1.00
R4197:Depdc5 UTSW 5 33,148,547 (GRCm39) missense possibly damaging 0.93
R4407:Depdc5 UTSW 5 33,061,878 (GRCm39) critical splice donor site probably null
R4534:Depdc5 UTSW 5 33,067,751 (GRCm39) critical splice acceptor site probably benign
R4535:Depdc5 UTSW 5 33,067,751 (GRCm39) critical splice acceptor site probably benign
R4538:Depdc5 UTSW 5 33,141,290 (GRCm39) missense probably damaging 1.00
R4613:Depdc5 UTSW 5 33,132,790 (GRCm39) missense probably damaging 1.00
R4736:Depdc5 UTSW 5 33,132,666 (GRCm39) missense probably benign
R4738:Depdc5 UTSW 5 33,132,666 (GRCm39) missense probably benign
R4765:Depdc5 UTSW 5 33,094,979 (GRCm39) missense probably damaging 1.00
R5021:Depdc5 UTSW 5 33,136,758 (GRCm39) missense probably damaging 1.00
R5259:Depdc5 UTSW 5 33,095,635 (GRCm39) missense probably damaging 1.00
R5261:Depdc5 UTSW 5 33,095,635 (GRCm39) missense probably damaging 1.00
R5541:Depdc5 UTSW 5 33,021,973 (GRCm39) utr 5 prime probably benign
R5594:Depdc5 UTSW 5 33,058,834 (GRCm39) missense possibly damaging 0.46
R5929:Depdc5 UTSW 5 33,132,850 (GRCm39) nonsense probably null
R6132:Depdc5 UTSW 5 33,067,811 (GRCm39) missense probably damaging 0.99
R6146:Depdc5 UTSW 5 33,126,075 (GRCm39) missense probably benign 0.01
R6336:Depdc5 UTSW 5 33,121,851 (GRCm39) splice site probably null
R6468:Depdc5 UTSW 5 33,069,575 (GRCm39) missense probably benign 0.02
R6911:Depdc5 UTSW 5 33,081,536 (GRCm39) missense probably damaging 1.00
R6969:Depdc5 UTSW 5 33,141,204 (GRCm39) missense probably damaging 1.00
R7002:Depdc5 UTSW 5 33,034,502 (GRCm39) splice site probably null
R7066:Depdc5 UTSW 5 33,059,192 (GRCm39) missense probably benign 0.08
R7231:Depdc5 UTSW 5 33,059,209 (GRCm39) missense possibly damaging 0.92
R7264:Depdc5 UTSW 5 33,125,089 (GRCm39) missense probably benign
R7302:Depdc5 UTSW 5 33,136,852 (GRCm39) missense probably damaging 1.00
R7386:Depdc5 UTSW 5 33,085,280 (GRCm39) missense probably benign
R7564:Depdc5 UTSW 5 33,058,854 (GRCm39) missense probably damaging 1.00
R7636:Depdc5 UTSW 5 33,075,327 (GRCm39) missense probably benign
R7795:Depdc5 UTSW 5 33,101,447 (GRCm39) missense probably damaging 1.00
R7845:Depdc5 UTSW 5 33,061,259 (GRCm39) splice site probably null
R8013:Depdc5 UTSW 5 33,131,186 (GRCm39) missense probably benign 0.01
R8037:Depdc5 UTSW 5 33,116,692 (GRCm39) critical splice donor site probably null
R8038:Depdc5 UTSW 5 33,116,692 (GRCm39) critical splice donor site probably null
R8065:Depdc5 UTSW 5 33,053,252 (GRCm39) missense possibly damaging 0.89
R8067:Depdc5 UTSW 5 33,053,252 (GRCm39) missense possibly damaging 0.89
R8108:Depdc5 UTSW 5 33,102,393 (GRCm39) missense probably benign 0.01
R8112:Depdc5 UTSW 5 33,126,050 (GRCm39) missense possibly damaging 0.67
R8213:Depdc5 UTSW 5 33,094,981 (GRCm39) missense probably damaging 1.00
R8382:Depdc5 UTSW 5 33,085,242 (GRCm39) missense probably benign 0.00
R8743:Depdc5 UTSW 5 33,081,587 (GRCm39) missense probably benign 0.10
R8754:Depdc5 UTSW 5 33,136,881 (GRCm39) missense probably benign 0.00
R9157:Depdc5 UTSW 5 33,102,452 (GRCm39) missense probably damaging 0.98
R9364:Depdc5 UTSW 5 33,122,076 (GRCm39) missense probably benign
R9441:Depdc5 UTSW 5 33,095,042 (GRCm39) missense probably benign 0.03
R9450:Depdc5 UTSW 5 33,091,354 (GRCm39) missense probably benign
R9459:Depdc5 UTSW 5 33,148,117 (GRCm39) missense probably damaging 0.99
R9554:Depdc5 UTSW 5 33,122,076 (GRCm39) missense probably benign
R9569:Depdc5 UTSW 5 33,025,321 (GRCm39) missense probably damaging 0.98
R9647:Depdc5 UTSW 5 33,081,567 (GRCm39) missense possibly damaging 0.94
R9688:Depdc5 UTSW 5 33,055,276 (GRCm39) nonsense probably null
X0027:Depdc5 UTSW 5 33,061,636 (GRCm39) missense probably damaging 1.00
Z1176:Depdc5 UTSW 5 33,100,626 (GRCm39) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TCTCATGGGATGAACTGATTTCTG -3'
(R):5'- CATCAGGCAAGGACACATGTG -3'

Sequencing Primer
(F):5'- CCCAGTTAGTACCGAGTACAGTG -3'
(R):5'- CATGTGTTAAAAGATGCACATACCC -3'
Posted On 2021-03-08