Incidental Mutation 'R8680:Casc1'
ID 661671
Institutional Source Beutler Lab
Gene Symbol Casc1
Ensembl Gene ENSMUSG00000043541
Gene Name cancer susceptibility candidate 1
Synonyms A230084G12Rik, Las1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R8680 (G1)
Quality Score 175.009
Status Validated
Chromosome 6
Chromosomal Location 145174834-145211005 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 145181816 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 456 (I456F)
Ref Sequence ENSEMBL: ENSMUSP00000062279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060797] [ENSMUST00000111728] [ENSMUST00000204105]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000060797
AA Change: I456F

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000062279
Gene: ENSMUSG00000043541
AA Change: I456F

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
Pfam:Casc1_N 29 229 5.5e-61 PFAM
Pfam:Casc1 241 469 3.4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111728
AA Change: I443F

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000107357
Gene: ENSMUSG00000043541
AA Change: I443F

DomainStartEndE-ValueType
coiled coil region 1 45 N/A INTRINSIC
Pfam:Casc1 228 456 6.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204105
AA Change: I456F

PolyPhen 2 Score 0.301 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000144783
Gene: ENSMUSG00000043541
AA Change: I456F

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
Pfam:Casc1_N 29 229 3.4e-57 PFAM
Pfam:Casc1 241 469 2.3e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.6%
Validation Efficiency 99% (78/79)
MGI Phenotype PHENOTYPE: Mice with disruptions of this gene display a higher incidence of lung tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik T C 16: 91,055,663 Y195C probably damaging Het
Abcb1a T A 5: 8,685,371 F159L probably damaging Het
Adam6b A G 12: 113,490,751 N396S probably benign Het
Adamts15 T C 9: 30,911,759 M338V possibly damaging Het
Adamts7 T A 9: 90,195,268 H1329Q probably damaging Het
Aim2 C T 1: 173,462,220 P243L probably damaging Het
Ankdd1a T C 9: 65,505,136 D311G probably damaging Het
Apon A T 10: 128,254,559 E35D probably benign Het
Atp1a4 T C 1: 172,250,999 D224G probably damaging Het
Atp6v0a1 T A 11: 101,062,403 *839R probably null Het
Bco2 A G 9: 50,550,578 L42P probably damaging Het
Bicral T A 17: 46,830,947 probably benign Het
Ccna1 T C 3: 55,048,457 Q306R probably benign Het
Cep152 G T 2: 125,564,211 S1467* probably null Het
Cfap44 T A 16: 44,404,722 V110E probably damaging Het
Clip2 G A 5: 134,502,608 A781V probably benign Het
Cps1 A T 1: 67,204,613 I1083F probably damaging Het
Cux1 A G 5: 136,307,856 V934A possibly damaging Het
Depdc5 T C 5: 32,944,038 F891L possibly damaging Het
Dnajc13 A G 9: 104,180,139 V1554A probably benign Het
Echs1 A T 7: 140,110,586 M191K probably damaging Het
Eif6 T A 2: 155,822,852 D238V probably benign Het
Fam71d TGATGTCACAGATGTCAC TGATGTCAC 12: 78,715,283 probably benign Het
Fat2 G A 11: 55,253,866 L4061F probably benign Het
Fat3 T C 9: 15,997,407 D2433G probably damaging Het
Flt3 A G 5: 147,383,455 V33A probably benign Het
Gpr155 T C 2: 73,343,695 E790G probably damaging Het
Ighv1-67 A T 12: 115,604,241 V17E probably damaging Het
Klra9 T A 6: 130,188,676 R125S probably damaging Het
Leo1 T C 9: 75,445,995 probably null Het
Map2 G T 1: 66,421,713 R1556L probably damaging Het
Megf8 A G 7: 25,359,741 probably null Het
Meikin T C 11: 54,426,651 I426T possibly damaging Het
Muc16 A T 9: 18,644,719 V3426E unknown Het
Olfr1061 T C 2: 86,413,591 I154V probably benign Het
Olfr12 T C 1: 92,619,921 V5A probably benign Het
Olfr1234 T A 2: 89,362,721 Y236F probably benign Het
Olfr609 G A 7: 103,492,822 L19F probably damaging Het
Olfr668 A G 7: 104,925,413 L117P probably damaging Het
Olfr859 T G 9: 19,808,809 S164A possibly damaging Het
Otogl A G 10: 107,912,075 probably null Het
Palm3 T C 8: 84,029,875 L672P probably damaging Het
Perm1 A G 4: 156,217,634 T212A probably benign Het
Poc1a T C 9: 106,349,761 M400T probably benign Het
Pou6f2 T A 13: 18,239,611 Q193L unknown Het
Ppl C T 16: 5,087,436 R1665H probably benign Het
Ppp4r3b T C 11: 29,173,449 probably null Het
Ptger1 T C 8: 83,668,025 S44P probably damaging Het
Pzp T C 6: 128,496,046 T787A probably benign Het
Rab44 A T 17: 29,139,668 R277* probably null Het
Rasgef1a T A 6: 118,087,127 I334K probably damaging Het
Rfx1 T C 8: 84,091,455 V554A possibly damaging Het
Ripk1 T A 13: 34,030,049 I518K possibly damaging Het
Rpl22 A G 4: 152,332,306 Y90C probably damaging Het
Rps27a C A 11: 29,545,998 R118L probably benign Het
Scmh1 T A 4: 120,462,134 S19T probably benign Het
Scn10a C T 9: 119,691,443 probably null Het
Sema4c A T 1: 36,550,786 S496T probably benign Het
Serpina3i T C 12: 104,265,128 V8A possibly damaging Het
Sis G A 3: 72,960,295 T139M probably damaging Het
Slc45a2 T A 15: 11,000,886 S24T probably benign Het
Slc5a11 A G 7: 123,267,752 I423M probably benign Het
Slc7a10 G A 7: 35,186,572 G31S probably benign Het
Sowahc A G 10: 59,223,179 N379S probably benign Het
Stat5a T C 11: 100,883,888 M741T unknown Het
Tcf15 T C 2: 152,144,100 S159P probably benign Het
Tdrd5 C A 1: 156,271,218 R669L possibly damaging Het
Tln1 T C 4: 43,553,041 E350G possibly damaging Het
Trim12c T G 7: 104,348,064 N95T Het
Ttc37 A T 13: 76,155,468 H1227L probably benign Het
Urb1 T C 16: 90,774,625 T1099A probably benign Het
Vmn1r44 T A 6: 89,893,596 V108D probably damaging Het
Vmn2r65 A G 7: 84,940,180 Y843H probably benign Het
Vmn2r68 A G 7: 85,222,113 I654T possibly damaging Het
Vps13a T C 19: 16,645,906 N2797S possibly damaging Het
Wscd2 T C 5: 113,574,174 Y385H probably damaging Het
Xdh T C 17: 73,922,505 I318V probably benign Het
Xrcc3 T A 12: 111,807,879 K172M probably damaging Het
Other mutations in Casc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Casc1 APN 6 145175290 missense probably benign 0.00
IGL00586:Casc1 APN 6 145191576 missense possibly damaging 0.53
IGL01066:Casc1 APN 6 145176222 missense probably damaging 0.96
IGL01413:Casc1 APN 6 145175086 missense probably damaging 1.00
IGL02275:Casc1 APN 6 145177364 missense probably damaging 1.00
IGL02668:Casc1 APN 6 145205257 missense unknown
IGL03018:Casc1 APN 6 145183305 missense probably damaging 1.00
IGL03233:Casc1 APN 6 145181885 missense probably damaging 1.00
R0011:Casc1 UTSW 6 145179055 missense probably damaging 1.00
R0011:Casc1 UTSW 6 145179055 missense probably damaging 1.00
R0180:Casc1 UTSW 6 145183218 critical splice donor site probably benign
R0786:Casc1 UTSW 6 145181757 critical splice donor site probably null
R1916:Casc1 UTSW 6 145176200 missense probably benign 0.37
R2117:Casc1 UTSW 6 145205241 critical splice donor site probably null
R2174:Casc1 UTSW 6 145175170 missense probably damaging 1.00
R2264:Casc1 UTSW 6 145208429 utr 5 prime probably benign
R4393:Casc1 UTSW 6 145194578 missense possibly damaging 0.49
R4467:Casc1 UTSW 6 145183218 critical splice donor site probably null
R4847:Casc1 UTSW 6 145175185 missense probably damaging 1.00
R5014:Casc1 UTSW 6 145183266 missense probably damaging 1.00
R5207:Casc1 UTSW 6 145179068 missense probably damaging 1.00
R5264:Casc1 UTSW 6 145181776 missense probably benign 0.02
R5359:Casc1 UTSW 6 145196892 missense probably damaging 1.00
R5499:Casc1 UTSW 6 145177431 missense probably damaging 1.00
R6211:Casc1 UTSW 6 145200491 missense probably damaging 1.00
R6579:Casc1 UTSW 6 145179018 missense probably benign 0.19
R6939:Casc1 UTSW 6 145175219 missense possibly damaging 0.46
R7108:Casc1 UTSW 6 145185865 nonsense probably null
R7131:Casc1 UTSW 6 145177406 missense probably null 0.97
R7810:Casc1 UTSW 6 145194586 missense probably benign 0.28
R8017:Casc1 UTSW 6 145194557 missense probably damaging 1.00
R8385:Casc1 UTSW 6 145175192 missense probably damaging 1.00
R8720:Casc1 UTSW 6 145205257 missense unknown
R9118:Casc1 UTSW 6 145175174 missense probably damaging 1.00
R9118:Casc1 UTSW 6 145175245 missense probably damaging 1.00
R9172:Casc1 UTSW 6 145177449 missense probably benign
R9290:Casc1 UTSW 6 145202962 missense unknown
X0063:Casc1 UTSW 6 145175271 missense probably benign 0.13
Z1176:Casc1 UTSW 6 145205293 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCCCAGAATTCCGGGCTCT -3'
(R):5'- GACAGGCTTAGTGACAAGTGC -3'

Sequencing Primer
(F):5'- CACTGGGATAAGGGAGCGTTG -3'
(R):5'- ACAAGTGCGTCTGGCCATTG -3'
Posted On 2021-03-08