Incidental Mutation 'R8680:Stat5a'
ID661703
Institutional Source Beutler Lab
Gene Symbol Stat5a
Ensembl Gene ENSMUSG00000004043
Gene Namesignal transducer and activator of transcription 5A
SynonymsSTAT5
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8680 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location100859351-100885169 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100883888 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 741 (M741T)
Ref Sequence ENSEMBL: ENSMUSP00000102980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004145] [ENSMUST00000092671] [ENSMUST00000103114] [ENSMUST00000107356] [ENSMUST00000107357] [ENSMUST00000127638] [ENSMUST00000138438]
Predicted Effect silent
Transcript: ENSMUST00000004145
SMART Domains Protein: ENSMUSP00000004145
Gene: ENSMUSG00000004043

DomainStartEndE-ValueType
STAT_int 2 126 4.42e-62 SMART
Pfam:STAT_alpha 138 330 6.9e-58 PFAM
Pfam:STAT_bind 332 583 2.4e-101 PFAM
SH2 587 688 7.64e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092671
SMART Domains Protein: ENSMUSP00000090342
Gene: ENSMUSG00000004040

DomainStartEndE-ValueType
STAT_int 2 122 3.03e-60 SMART
Pfam:STAT_alpha 138 319 2.2e-62 PFAM
Pfam:STAT_bind 321 574 1.8e-130 PFAM
SH2 582 663 2.84e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103114
SMART Domains Protein: ENSMUSP00000099403
Gene: ENSMUSG00000004040

DomainStartEndE-ValueType
STAT_int 2 122 3.03e-60 SMART
Pfam:STAT_alpha 138 319 7.2e-62 PFAM
Pfam:STAT_bind 321 574 5.7e-130 PFAM
SH2 582 663 2.84e-1 SMART
Predicted Effect silent
Transcript: ENSMUST00000107356
SMART Domains Protein: ENSMUSP00000102979
Gene: ENSMUSG00000004043

DomainStartEndE-ValueType
STAT_int 2 126 4.42e-62 SMART
Pfam:STAT_alpha 138 330 6.9e-58 PFAM
Pfam:STAT_bind 332 583 2.4e-101 PFAM
SH2 587 688 7.64e-6 SMART
Predicted Effect unknown
Transcript: ENSMUST00000107357
AA Change: M741T
SMART Domains Protein: ENSMUSP00000102980
Gene: ENSMUSG00000004043
AA Change: M741T

DomainStartEndE-ValueType
STAT_int 2 126 4.42e-62 SMART
Pfam:STAT_alpha 141 330 4.5e-57 PFAM
Pfam:STAT_bind 332 582 1e-104 PFAM
SH2 587 688 1.55e-6 SMART
low complexity region 713 729 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127638
SMART Domains Protein: ENSMUSP00000120152
Gene: ENSMUSG00000004040

DomainStartEndE-ValueType
STAT_int 2 122 3.03e-60 SMART
Pfam:STAT_alpha 141 319 6.8e-59 PFAM
Pfam:STAT_bind 321 573 2.5e-80 PFAM
SH2 582 663 2.84e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138438
SMART Domains Protein: ENSMUSP00000121677
Gene: ENSMUSG00000004040

DomainStartEndE-ValueType
STAT_int 2 123 5.47e-35 SMART
coiled coil region 171 195 N/A INTRINSIC
coiled coil region 243 265 N/A INTRINSIC
Pfam:STAT_bind 295 548 9.2e-131 PFAM
SH2 556 637 2.84e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.6%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein is activated by, and mediates the responses of many cell ligands, such as IL2, IL3, IL7 GM-CSF, erythropoietin, thrombopoietin, and different growth hormones. Activation of this protein in myeloma and lymphoma associated with a TEL/JAK2 gene fusion is independent of cell stimulus and has been shown to be essential for tumorigenesis. The mouse counterpart of this gene is found to induce the expression of BCL2L1/BCL-X(L), which suggests the antiapoptotic function of this gene in cells. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene are reduced in size and display abnormalities in both mammary gland structure and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik T C 16: 91,055,663 Y195C probably damaging Het
Abcb1a T A 5: 8,685,371 F159L probably damaging Het
Adam6b A G 12: 113,490,751 N396S probably benign Het
Adamts15 T C 9: 30,911,759 M338V possibly damaging Het
Adamts7 T A 9: 90,195,268 H1329Q probably damaging Het
Aim2 C T 1: 173,462,220 P243L probably damaging Het
Ankdd1a T C 9: 65,505,136 D311G probably damaging Het
Apon A T 10: 128,254,559 E35D probably benign Het
Atp1a4 T C 1: 172,250,999 D224G probably damaging Het
Atp6v0a1 T A 11: 101,062,403 *839R probably null Het
Bco2 A G 9: 50,550,578 L42P probably damaging Het
Bicral T A 17: 46,830,947 probably benign Het
Casc1 T A 6: 145,181,816 I456F probably benign Het
Ccna1 T C 3: 55,048,457 Q306R probably benign Het
Cep152 G T 2: 125,564,211 S1467* probably null Het
Cfap44 T A 16: 44,404,722 V110E probably damaging Het
Clip2 G A 5: 134,502,608 A781V probably benign Het
Cps1 A T 1: 67,204,613 I1083F probably damaging Het
Cux1 A G 5: 136,307,856 V934A possibly damaging Het
Depdc5 T C 5: 32,944,038 F891L possibly damaging Het
Dnajc13 A G 9: 104,180,139 V1554A probably benign Het
Echs1 A T 7: 140,110,586 M191K probably damaging Het
Eif6 T A 2: 155,822,852 D238V probably benign Het
Fam71d TGATGTCACAGATGTCAC TGATGTCAC 12: 78,715,283 probably benign Het
Fat2 G A 11: 55,253,866 L4061F probably benign Het
Fat3 T C 9: 15,997,407 D2433G probably damaging Het
Flt3 A G 5: 147,383,455 V33A probably benign Het
Gpr155 T C 2: 73,343,695 E790G probably damaging Het
Ighv1-67 A T 12: 115,604,241 V17E probably damaging Het
Klra9 T A 6: 130,188,676 R125S probably damaging Het
Leo1 T C 9: 75,445,995 probably null Het
Map2 G T 1: 66,421,713 R1556L probably damaging Het
Megf8 A G 7: 25,359,741 probably null Het
Meikin T C 11: 54,426,651 I426T possibly damaging Het
Muc16 A T 9: 18,644,719 V3426E unknown Het
Olfr1061 T C 2: 86,413,591 I154V probably benign Het
Olfr12 T C 1: 92,619,921 V5A probably benign Het
Olfr1234 T A 2: 89,362,721 Y236F probably benign Het
Olfr609 G A 7: 103,492,822 L19F probably damaging Het
Olfr668 A G 7: 104,925,413 L117P probably damaging Het
Olfr859 T G 9: 19,808,809 S164A possibly damaging Het
Otogl A G 10: 107,912,075 probably null Het
Palm3 T C 8: 84,029,875 L672P probably damaging Het
Perm1 A G 4: 156,217,634 T212A probably benign Het
Poc1a T C 9: 106,349,761 M400T probably benign Het
Pou6f2 T A 13: 18,239,611 Q193L unknown Het
Ppl C T 16: 5,087,436 R1665H probably benign Het
Ppp4r3b T C 11: 29,173,449 probably null Het
Ptger1 T C 8: 83,668,025 S44P probably damaging Het
Pzp T C 6: 128,496,046 T787A probably benign Het
Rab44 A T 17: 29,139,668 R277* probably null Het
Rasgef1a T A 6: 118,087,127 I334K probably damaging Het
Rfx1 T C 8: 84,091,455 V554A possibly damaging Het
Ripk1 T A 13: 34,030,049 I518K possibly damaging Het
Rpl22 A G 4: 152,332,306 Y90C probably damaging Het
Rps27a C A 11: 29,545,998 R118L probably benign Het
Scmh1 T A 4: 120,462,134 S19T probably benign Het
Scn10a C T 9: 119,691,443 probably null Het
Sema4c A T 1: 36,550,786 S496T probably benign Het
Serpina3i T C 12: 104,265,128 V8A possibly damaging Het
Sis G A 3: 72,960,295 T139M probably damaging Het
Slc45a2 T A 15: 11,000,886 S24T probably benign Het
Slc5a11 A G 7: 123,267,752 I423M probably benign Het
Slc7a10 G A 7: 35,186,572 G31S probably benign Het
Sowahc A G 10: 59,223,179 N379S probably benign Het
Tcf15 T C 2: 152,144,100 S159P probably benign Het
Tdrd5 C A 1: 156,271,218 R669L possibly damaging Het
Tln1 T C 4: 43,553,041 E350G possibly damaging Het
Trim12c T G 7: 104,348,064 N95T Het
Ttc37 A T 13: 76,155,468 H1227L probably benign Het
Urb1 T C 16: 90,774,625 T1099A probably benign Het
Vmn1r44 T A 6: 89,893,596 V108D probably damaging Het
Vmn2r65 A G 7: 84,940,180 Y843H probably benign Het
Vmn2r68 A G 7: 85,222,113 I654T possibly damaging Het
Vps13a T C 19: 16,645,906 N2797S possibly damaging Het
Wscd2 T C 5: 113,574,174 Y385H probably damaging Het
Xdh T C 17: 73,922,505 I318V probably benign Het
Xrcc3 T A 12: 111,807,879 K172M probably damaging Het
Other mutations in Stat5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01352:Stat5a APN 11 100881072 missense probably damaging 1.00
IGL02021:Stat5a APN 11 100883889 missense probably damaging 1.00
IGL02032:Stat5a APN 11 100861828 missense probably damaging 0.99
IGL03108:Stat5a APN 11 100863139 nonsense probably null
IGL03160:Stat5a APN 11 100861845 missense possibly damaging 0.71
hohum UTSW 11 100874129 missense probably damaging 1.00
R8176_stat5a_357 UTSW 11 100876863 missense probably damaging 1.00
yawn UTSW 11 100879693 missense possibly damaging 0.50
R0098:Stat5a UTSW 11 100875626 missense probably damaging 0.98
R0362:Stat5a UTSW 11 100882083 missense probably benign 0.01
R0452:Stat5a UTSW 11 100863135 missense probably benign 0.20
R0520:Stat5a UTSW 11 100861426 missense probably damaging 0.98
R0815:Stat5a UTSW 11 100875082 splice site probably null
R1081:Stat5a UTSW 11 100881060 missense probably damaging 1.00
R1752:Stat5a UTSW 11 100884058 makesense probably null
R1774:Stat5a UTSW 11 100879286 missense probably damaging 1.00
R1868:Stat5a UTSW 11 100874129 missense probably damaging 1.00
R2152:Stat5a UTSW 11 100874090 missense probably benign 0.38
R2900:Stat5a UTSW 11 100874131 missense probably benign 0.18
R4023:Stat5a UTSW 11 100874926 nonsense probably null
R4791:Stat5a UTSW 11 100865463 missense probably damaging 1.00
R5396:Stat5a UTSW 11 100880583 missense probably damaging 1.00
R5641:Stat5a UTSW 11 100876808 missense probably benign 0.01
R5723:Stat5a UTSW 11 100882074 missense probably benign 0.00
R5896:Stat5a UTSW 11 100877057 missense possibly damaging 0.94
R6026:Stat5a UTSW 11 100880316 missense probably damaging 1.00
R7052:Stat5a UTSW 11 100879285 missense probably damaging 1.00
R7075:Stat5a UTSW 11 100879693 missense possibly damaging 0.50
R7568:Stat5a UTSW 11 100875024 missense possibly damaging 0.74
R7771:Stat5a UTSW 11 100863219 missense probably benign 0.34
R7801:Stat5a UTSW 11 100880317 missense probably damaging 1.00
R7814:Stat5a UTSW 11 100875027 missense probably damaging 1.00
R7856:Stat5a UTSW 11 100883902 missense unknown
R8176:Stat5a UTSW 11 100876863 missense probably damaging 1.00
R8234:Stat5a UTSW 11 100879303 missense possibly damaging 0.59
R8923:Stat5a UTSW 11 100880482 missense
Predicted Primers PCR Primer
(F):5'- TGGAATGGAAGTAGATTATCTTCCCC -3'
(R):5'- ACTACAACTGACGTGGGCTC -3'

Sequencing Primer
(F):5'- GGAAGTAGATTATCTTCCCCAATCC -3'
(R):5'- TGGGCTCCTCACACTGAAG -3'
Posted On2021-03-08