Incidental Mutation 'R8680:Xdh'
ID661719
Institutional Source Beutler Lab
Gene Symbol Xdh
Ensembl Gene ENSMUSG00000024066
Gene Namexanthine dehydrogenase
Synonymsxanthine oxidase, XO, Xor, Xox1, Xox-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.280) question?
Stock #R8680 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location73883908-73950182 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73922505 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 318 (I318V)
Ref Sequence ENSEMBL: ENSMUSP00000024866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024866]
AlphaFold Q00519
Predicted Effect probably benign
Transcript: ENSMUST00000024866
AA Change: I318V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024866
Gene: ENSMUSG00000024066
AA Change: I318V

DomainStartEndE-ValueType
Pfam:Fer2 11 81 5e-12 PFAM
Pfam:Fer2_2 90 163 4.1e-31 PFAM
low complexity region 169 182 N/A INTRINSIC
Pfam:FAD_binding_5 234 414 4.9e-47 PFAM
CO_deh_flav_C 421 525 1.16e-24 SMART
Ald_Xan_dh_C 590 696 1.23e-46 SMART
Pfam:Ald_Xan_dh_C2 704 1239 1e-200 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.6%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: This gene encodes a member of the xanthine dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein exists as two distinct enzymatic forms, either as xanthine dehydrogenase, or as xanthine oxidase, and functions in purine degradation. Additional studies also suggest a role in adipogenesis, and a function as a structural protein in milk fat droplets in the lactating mammary gland. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele are small and die prematurely while heterozygous females show a lactation defect. Most homozygotes for another null allele die within the first month of renal failure associated with uric acid depletion, renal tubular damage, inflammation, fibrosis and oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik T C 16: 91,055,663 Y195C probably damaging Het
Abcb1a T A 5: 8,685,371 F159L probably damaging Het
Adam6b A G 12: 113,490,751 N396S probably benign Het
Adamts15 T C 9: 30,911,759 M338V possibly damaging Het
Adamts7 T A 9: 90,195,268 H1329Q probably damaging Het
Aim2 C T 1: 173,462,220 P243L probably damaging Het
Ankdd1a T C 9: 65,505,136 D311G probably damaging Het
Apon A T 10: 128,254,559 E35D probably benign Het
Atp1a4 T C 1: 172,250,999 D224G probably damaging Het
Atp6v0a1 T A 11: 101,062,403 *839R probably null Het
Bco2 A G 9: 50,550,578 L42P probably damaging Het
Bicral T A 17: 46,830,947 probably benign Het
Casc1 T A 6: 145,181,816 I456F probably benign Het
Ccna1 T C 3: 55,048,457 Q306R probably benign Het
Cep152 G T 2: 125,564,211 S1467* probably null Het
Cfap44 T A 16: 44,404,722 V110E probably damaging Het
Clip2 G A 5: 134,502,608 A781V probably benign Het
Cps1 A T 1: 67,204,613 I1083F probably damaging Het
Cux1 A G 5: 136,307,856 V934A possibly damaging Het
Depdc5 T C 5: 32,944,038 F891L possibly damaging Het
Dnajc13 A G 9: 104,180,139 V1554A probably benign Het
Echs1 A T 7: 140,110,586 M191K probably damaging Het
Eif6 T A 2: 155,822,852 D238V probably benign Het
Fam71d TGATGTCACAGATGTCAC TGATGTCAC 12: 78,715,283 probably benign Het
Fat2 G A 11: 55,253,866 L4061F probably benign Het
Fat3 T C 9: 15,997,407 D2433G probably damaging Het
Flt3 A G 5: 147,383,455 V33A probably benign Het
Gpr155 T C 2: 73,343,695 E790G probably damaging Het
Ighv1-67 A T 12: 115,604,241 V17E probably damaging Het
Klra9 T A 6: 130,188,676 R125S probably damaging Het
Leo1 T C 9: 75,445,995 probably null Het
Map2 G T 1: 66,421,713 R1556L probably damaging Het
Megf8 A G 7: 25,359,741 probably null Het
Meikin T C 11: 54,426,651 I426T possibly damaging Het
Muc16 A T 9: 18,644,719 V3426E unknown Het
Olfr1061 T C 2: 86,413,591 I154V probably benign Het
Olfr12 T C 1: 92,619,921 V5A probably benign Het
Olfr1234 T A 2: 89,362,721 Y236F probably benign Het
Olfr609 G A 7: 103,492,822 L19F probably damaging Het
Olfr668 A G 7: 104,925,413 L117P probably damaging Het
Olfr859 T G 9: 19,808,809 S164A possibly damaging Het
Otogl A G 10: 107,912,075 probably null Het
Palm3 T C 8: 84,029,875 L672P probably damaging Het
Perm1 A G 4: 156,217,634 T212A probably benign Het
Poc1a T C 9: 106,349,761 M400T probably benign Het
Pou6f2 T A 13: 18,239,611 Q193L unknown Het
Ppl C T 16: 5,087,436 R1665H probably benign Het
Ppp4r3b T C 11: 29,173,449 probably null Het
Ptger1 T C 8: 83,668,025 S44P probably damaging Het
Pzp T C 6: 128,496,046 T787A probably benign Het
Rab44 A T 17: 29,139,668 R277* probably null Het
Rasgef1a T A 6: 118,087,127 I334K probably damaging Het
Rfx1 T C 8: 84,091,455 V554A possibly damaging Het
Ripk1 T A 13: 34,030,049 I518K possibly damaging Het
Rpl22 A G 4: 152,332,306 Y90C probably damaging Het
Rps27a C A 11: 29,545,998 R118L probably benign Het
Scmh1 T A 4: 120,462,134 S19T probably benign Het
Scn10a C T 9: 119,691,443 probably null Het
Sema4c A T 1: 36,550,786 S496T probably benign Het
Serpina3i T C 12: 104,265,128 V8A possibly damaging Het
Sis G A 3: 72,960,295 T139M probably damaging Het
Slc45a2 T A 15: 11,000,886 S24T probably benign Het
Slc5a11 A G 7: 123,267,752 I423M probably benign Het
Slc7a10 G A 7: 35,186,572 G31S probably benign Het
Sowahc A G 10: 59,223,179 N379S probably benign Het
Stat5a T C 11: 100,883,888 M741T unknown Het
Tcf15 T C 2: 152,144,100 S159P probably benign Het
Tdrd5 C A 1: 156,271,218 R669L possibly damaging Het
Tln1 T C 4: 43,553,041 E350G possibly damaging Het
Trim12c T G 7: 104,348,064 N95T Het
Ttc37 A T 13: 76,155,468 H1227L probably benign Het
Urb1 T C 16: 90,774,625 T1099A probably benign Het
Vmn1r44 T A 6: 89,893,596 V108D probably damaging Het
Vmn2r65 A G 7: 84,940,180 Y843H probably benign Het
Vmn2r68 A G 7: 85,222,113 I654T possibly damaging Het
Vps13a T C 19: 16,645,906 N2797S possibly damaging Het
Wscd2 T C 5: 113,574,174 Y385H probably damaging Het
Xrcc3 T A 12: 111,807,879 K172M probably damaging Het
Other mutations in Xdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Xdh APN 17 73923106 missense possibly damaging 0.58
IGL00556:Xdh APN 17 73884435 makesense probably null
IGL01524:Xdh APN 17 73923137 critical splice acceptor site probably null
IGL01604:Xdh APN 17 73909337 missense probably benign 0.02
IGL01625:Xdh APN 17 73916786 critical splice donor site probably null
IGL01778:Xdh APN 17 73900280 missense probably benign 0.00
IGL01804:Xdh APN 17 73892759 missense probably damaging 1.00
IGL01825:Xdh APN 17 73891245 missense probably damaging 1.00
IGL01929:Xdh APN 17 73934855 missense probably damaging 1.00
IGL02068:Xdh APN 17 73913950 missense probably damaging 1.00
IGL02079:Xdh APN 17 73891277 missense probably damaging 1.00
IGL02210:Xdh APN 17 73943895 missense probably benign 0.00
IGL02261:Xdh APN 17 73913965 missense possibly damaging 0.81
IGL02365:Xdh APN 17 73943890 missense probably benign 0.14
IGL02424:Xdh APN 17 73926570 missense probably benign 0.00
IGL02491:Xdh APN 17 73886464 missense probably damaging 0.99
IGL02525:Xdh APN 17 73924995 missense possibly damaging 0.91
IGL02578:Xdh APN 17 73906246 missense probably damaging 1.00
IGL02793:Xdh APN 17 73900581 missense probably damaging 1.00
IGL02939:Xdh APN 17 73943845 critical splice donor site probably null
IGL03327:Xdh APN 17 73916792 missense probably benign
IGL03345:Xdh APN 17 73906032 missense probably damaging 0.98
IGL03353:Xdh APN 17 73895786 missense possibly damaging 0.65
R0018:Xdh UTSW 17 73925025 missense probably benign 0.00
R0018:Xdh UTSW 17 73925025 missense probably benign 0.00
R0033:Xdh UTSW 17 73907632 missense probably benign 0.06
R0079:Xdh UTSW 17 73891218 missense probably damaging 1.00
R0086:Xdh UTSW 17 73884438 missense probably benign
R0319:Xdh UTSW 17 73906101 splice site probably benign
R0336:Xdh UTSW 17 73922463 missense possibly damaging 0.91
R0389:Xdh UTSW 17 73898362 missense probably damaging 1.00
R0684:Xdh UTSW 17 73943891 missense probably damaging 0.97
R0930:Xdh UTSW 17 73923082 missense probably benign 0.00
R1073:Xdh UTSW 17 73939836 missense probably benign
R1114:Xdh UTSW 17 73941149 splice site probably benign
R1201:Xdh UTSW 17 73918418 missense probably benign 0.05
R1230:Xdh UTSW 17 73891256 missense probably damaging 1.00
R1351:Xdh UTSW 17 73923078 missense probably benign 0.02
R1470:Xdh UTSW 17 73891112 missense probably damaging 1.00
R1470:Xdh UTSW 17 73891112 missense probably damaging 1.00
R1485:Xdh UTSW 17 73914019 nonsense probably null
R1548:Xdh UTSW 17 73913901 missense probably damaging 0.98
R1637:Xdh UTSW 17 73900578 missense probably benign
R1641:Xdh UTSW 17 73926552 missense probably benign
R1758:Xdh UTSW 17 73910209 missense probably damaging 1.00
R1951:Xdh UTSW 17 73907658 missense probably damaging 1.00
R1969:Xdh UTSW 17 73892751 missense possibly damaging 0.55
R2024:Xdh UTSW 17 73921305 missense possibly damaging 0.92
R2080:Xdh UTSW 17 73909325 missense probably damaging 1.00
R2157:Xdh UTSW 17 73922537 missense probably damaging 1.00
R2300:Xdh UTSW 17 73891265 missense probably damaging 1.00
R3783:Xdh UTSW 17 73893595 splice site probably benign
R3796:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3797:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3798:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3799:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3819:Xdh UTSW 17 73906725 missense probably benign 0.35
R4085:Xdh UTSW 17 73916879 missense probably benign 0.35
R4240:Xdh UTSW 17 73895795 missense possibly damaging 0.72
R4356:Xdh UTSW 17 73915690 missense probably benign 0.01
R4522:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4523:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4524:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4600:Xdh UTSW 17 73910200 missense probably benign 0.19
R4617:Xdh UTSW 17 73918394 missense probably damaging 0.99
R4756:Xdh UTSW 17 73886386 missense probably benign 0.24
R4761:Xdh UTSW 17 73910267 missense possibly damaging 0.91
R4815:Xdh UTSW 17 73906215 missense probably damaging 1.00
R4850:Xdh UTSW 17 73898335 missense probably damaging 1.00
R4896:Xdh UTSW 17 73910243 missense probably damaging 0.96
R4897:Xdh UTSW 17 73900708 missense probably benign
R4923:Xdh UTSW 17 73924936 missense possibly damaging 0.72
R4977:Xdh UTSW 17 73898970 missense probably benign 0.05
R5030:Xdh UTSW 17 73891293 missense probably damaging 1.00
R5185:Xdh UTSW 17 73925011 missense probably damaging 1.00
R5347:Xdh UTSW 17 73925032 missense probably benign
R5556:Xdh UTSW 17 73897764 missense probably benign 0.21
R5566:Xdh UTSW 17 73893622 missense probably damaging 1.00
R5568:Xdh UTSW 17 73943885 missense possibly damaging 0.90
R5635:Xdh UTSW 17 73913875 missense possibly damaging 0.92
R5662:Xdh UTSW 17 73941115 missense probably damaging 0.99
R5955:Xdh UTSW 17 73898320 missense probably damaging 1.00
R6058:Xdh UTSW 17 73906269 missense probably damaging 1.00
R6061:Xdh UTSW 17 73921347 missense probably damaging 1.00
R6412:Xdh UTSW 17 73935907 missense probably benign 0.09
R6526:Xdh UTSW 17 73900551 missense probably damaging 0.97
R6558:Xdh UTSW 17 73893713 missense possibly damaging 0.95
R6843:Xdh UTSW 17 73923130 missense probably damaging 1.00
R6932:Xdh UTSW 17 73922562 missense probably damaging 0.99
R7028:Xdh UTSW 17 73943873 missense probably damaging 0.99
R7418:Xdh UTSW 17 73913965 missense possibly damaging 0.81
R7503:Xdh UTSW 17 73926210 missense probably damaging 1.00
R7653:Xdh UTSW 17 73897045 missense probably benign 0.10
R7763:Xdh UTSW 17 73934834 missense possibly damaging 0.69
R7768:Xdh UTSW 17 73939836 missense probably benign
R7904:Xdh UTSW 17 73922472 missense probably benign 0.09
R8010:Xdh UTSW 17 73909317 nonsense probably null
R8067:Xdh UTSW 17 73900657 missense probably benign 0.01
R8238:Xdh UTSW 17 73886417 missense probably benign
R8253:Xdh UTSW 17 73918382 missense possibly damaging 0.94
R8346:Xdh UTSW 17 73913943 missense probably damaging 1.00
R8350:Xdh UTSW 17 73934842 missense probably damaging 1.00
R8381:Xdh UTSW 17 73912461 missense probably benign
R8427:Xdh UTSW 17 73935931 missense probably damaging 1.00
R8465:Xdh UTSW 17 73899012 nonsense probably null
R8478:Xdh UTSW 17 73906058 missense probably benign 0.00
R8802:Xdh UTSW 17 73918410 missense probably benign 0.00
R8984:Xdh UTSW 17 73921351 missense probably damaging 1.00
R8985:Xdh UTSW 17 73921351 missense probably damaging 1.00
R8995:Xdh UTSW 17 73898374 missense probably damaging 1.00
R9035:Xdh UTSW 17 73910227 missense probably benign
X0019:Xdh UTSW 17 73918454 missense probably damaging 1.00
Z1088:Xdh UTSW 17 73886428 missense probably benign
Z1176:Xdh UTSW 17 73923042 critical splice donor site probably null
Z1177:Xdh UTSW 17 73897695 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGCCATCTTCATGAAACTTCC -3'
(R):5'- GGTATAGACATCGTCCCAGCTC -3'

Sequencing Primer
(F):5'- ATCTTCATGAAACTTCCCAGGG -3'
(R):5'- ATCGTCCCAGCTCATGTCGAG -3'
Posted On2021-03-08