Incidental Mutation 'R8680:Xdh'
ID 661719
Institutional Source Beutler Lab
Gene Symbol Xdh
Ensembl Gene ENSMUSG00000024066
Gene Name xanthine dehydrogenase
Synonyms Xox-1, XO, Xor, Xox1, xanthine oxidase
MMRRC Submission 068535-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.453) question?
Stock # R8680 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 74190890-74257191 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 74229500 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 318 (I318V)
Ref Sequence ENSEMBL: ENSMUSP00000024866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024866]
AlphaFold Q00519
Predicted Effect probably benign
Transcript: ENSMUST00000024866
AA Change: I318V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024866
Gene: ENSMUSG00000024066
AA Change: I318V

DomainStartEndE-ValueType
Pfam:Fer2 11 81 5e-12 PFAM
Pfam:Fer2_2 90 163 4.1e-31 PFAM
low complexity region 169 182 N/A INTRINSIC
Pfam:FAD_binding_5 234 414 4.9e-47 PFAM
CO_deh_flav_C 421 525 1.16e-24 SMART
Ald_Xan_dh_C 590 696 1.23e-46 SMART
Pfam:Ald_Xan_dh_C2 704 1239 1e-200 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.6%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: This gene encodes a member of the xanthine dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein exists as two distinct enzymatic forms, either as xanthine dehydrogenase, or as xanthine oxidase, and functions in purine degradation. Additional studies also suggest a role in adipogenesis, and a function as a structural protein in milk fat droplets in the lactating mammary gland. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele are small and die prematurely while heterozygous females show a lactation defect. Most homozygotes for another null allele die within the first month of renal failure associated with uric acid depletion, renal tubular damage, inflammation, fibrosis and oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik T C 16: 90,852,551 (GRCm39) Y195C probably damaging Het
Abcb1a T A 5: 8,735,371 (GRCm39) F159L probably damaging Het
Adam6b A G 12: 113,454,371 (GRCm39) N396S probably benign Het
Adamts15 T C 9: 30,823,055 (GRCm39) M338V possibly damaging Het
Adamts7 T A 9: 90,077,321 (GRCm39) H1329Q probably damaging Het
Aim2 C T 1: 173,289,786 (GRCm39) P243L probably damaging Het
Ankdd1a T C 9: 65,412,418 (GRCm39) D311G probably damaging Het
Apon A T 10: 128,090,428 (GRCm39) E35D probably benign Het
Atp1a4 T C 1: 172,078,566 (GRCm39) D224G probably damaging Het
Atp6v0a1 T A 11: 100,953,229 (GRCm39) *839R probably null Het
Bco2 A G 9: 50,461,878 (GRCm39) L42P probably damaging Het
Bicral T A 17: 47,141,873 (GRCm39) probably benign Het
Ccna1 T C 3: 54,955,878 (GRCm39) Q306R probably benign Het
Cep152 G T 2: 125,406,131 (GRCm39) S1467* probably null Het
Cfap44 T A 16: 44,225,085 (GRCm39) V110E probably damaging Het
Clip2 G A 5: 134,531,462 (GRCm39) A781V probably benign Het
Cps1 A T 1: 67,243,772 (GRCm39) I1083F probably damaging Het
Cux1 A G 5: 136,336,710 (GRCm39) V934A possibly damaging Het
Depdc5 T C 5: 33,101,382 (GRCm39) F891L possibly damaging Het
Dnai7 T A 6: 145,127,542 (GRCm39) I456F probably benign Het
Dnajc13 A G 9: 104,057,338 (GRCm39) V1554A probably benign Het
Echs1 A T 7: 139,690,499 (GRCm39) M191K probably damaging Het
Eif6 T A 2: 155,664,772 (GRCm39) D238V probably benign Het
Fat2 G A 11: 55,144,692 (GRCm39) L4061F probably benign Het
Fat3 T C 9: 15,908,703 (GRCm39) D2433G probably damaging Het
Flt3 A G 5: 147,320,265 (GRCm39) V33A probably benign Het
Garin2 TGATGTCACAGATGTCAC TGATGTCAC 12: 78,762,057 (GRCm39) probably benign Het
Gpr155 T C 2: 73,174,039 (GRCm39) E790G probably damaging Het
Ighv1-67 A T 12: 115,567,861 (GRCm39) V17E probably damaging Het
Klra9 T A 6: 130,165,639 (GRCm39) R125S probably damaging Het
Leo1 T C 9: 75,353,277 (GRCm39) probably null Het
Map2 G T 1: 66,460,872 (GRCm39) R1556L probably damaging Het
Megf8 A G 7: 25,059,166 (GRCm39) probably null Het
Meikin T C 11: 54,317,477 (GRCm39) I426T possibly damaging Het
Muc16 A T 9: 18,556,015 (GRCm39) V3426E unknown Het
Or4a15 T A 2: 89,193,065 (GRCm39) Y236F probably benign Het
Or51af1 G A 7: 103,142,029 (GRCm39) L19F probably damaging Het
Or52n2c A G 7: 104,574,620 (GRCm39) L117P probably damaging Het
Or7e168 T G 9: 19,720,105 (GRCm39) S164A possibly damaging Het
Or8k25 T C 2: 86,243,935 (GRCm39) I154V probably benign Het
Or9s13 T C 1: 92,547,643 (GRCm39) V5A probably benign Het
Otogl A G 10: 107,747,936 (GRCm39) probably null Het
Palm3 T C 8: 84,756,504 (GRCm39) L672P probably damaging Het
Perm1 A G 4: 156,302,091 (GRCm39) T212A probably benign Het
Poc1a T C 9: 106,226,960 (GRCm39) M400T probably benign Het
Pou6f2 T A 13: 18,414,196 (GRCm39) Q193L unknown Het
Ppl C T 16: 4,905,300 (GRCm39) R1665H probably benign Het
Ppp4r3b T C 11: 29,123,449 (GRCm39) probably null Het
Ptger1 T C 8: 84,394,654 (GRCm39) S44P probably damaging Het
Pzp T C 6: 128,473,009 (GRCm39) T787A probably benign Het
Rab44 A T 17: 29,358,642 (GRCm39) R277* probably null Het
Rasgef1a T A 6: 118,064,088 (GRCm39) I334K probably damaging Het
Rfx1 T C 8: 84,818,084 (GRCm39) V554A possibly damaging Het
Ripk1 T A 13: 34,214,032 (GRCm39) I518K possibly damaging Het
Rpl22 A G 4: 152,416,763 (GRCm39) Y90C probably damaging Het
Rps27a C A 11: 29,495,998 (GRCm39) R118L probably benign Het
Scmh1 T A 4: 120,319,331 (GRCm39) S19T probably benign Het
Scn10a C T 9: 119,520,509 (GRCm39) probably null Het
Sema4c A T 1: 36,589,867 (GRCm39) S496T probably benign Het
Serpina3i T C 12: 104,231,387 (GRCm39) V8A possibly damaging Het
Sis G A 3: 72,867,628 (GRCm39) T139M probably damaging Het
Skic3 A T 13: 76,303,587 (GRCm39) H1227L probably benign Het
Slc45a2 T A 15: 11,000,972 (GRCm39) S24T probably benign Het
Slc5a11 A G 7: 122,866,975 (GRCm39) I423M probably benign Het
Slc7a10 G A 7: 34,885,997 (GRCm39) G31S probably benign Het
Sowahc A G 10: 59,059,001 (GRCm39) N379S probably benign Het
Stat5a T C 11: 100,774,714 (GRCm39) M741T unknown Het
Tcf15 T C 2: 151,986,020 (GRCm39) S159P probably benign Het
Tdrd5 C A 1: 156,098,788 (GRCm39) R669L possibly damaging Het
Tln1 T C 4: 43,553,041 (GRCm39) E350G possibly damaging Het
Trim12c T G 7: 103,997,271 (GRCm39) N95T Het
Urb1 T C 16: 90,571,513 (GRCm39) T1099A probably benign Het
Vmn1r44 T A 6: 89,870,578 (GRCm39) V108D probably damaging Het
Vmn2r65 A G 7: 84,589,388 (GRCm39) Y843H probably benign Het
Vmn2r68 A G 7: 84,871,321 (GRCm39) I654T possibly damaging Het
Vps13a T C 19: 16,623,270 (GRCm39) N2797S possibly damaging Het
Wscd2 T C 5: 113,712,235 (GRCm39) Y385H probably damaging Het
Xrcc3 T A 12: 111,774,313 (GRCm39) K172M probably damaging Het
Other mutations in Xdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Xdh APN 17 74,230,101 (GRCm39) missense possibly damaging 0.58
IGL00556:Xdh APN 17 74,191,430 (GRCm39) makesense probably null
IGL01524:Xdh APN 17 74,230,132 (GRCm39) critical splice acceptor site probably null
IGL01604:Xdh APN 17 74,216,332 (GRCm39) missense probably benign 0.02
IGL01625:Xdh APN 17 74,223,781 (GRCm39) critical splice donor site probably null
IGL01778:Xdh APN 17 74,207,275 (GRCm39) missense probably benign 0.00
IGL01804:Xdh APN 17 74,199,754 (GRCm39) missense probably damaging 1.00
IGL01825:Xdh APN 17 74,198,240 (GRCm39) missense probably damaging 1.00
IGL01929:Xdh APN 17 74,241,850 (GRCm39) missense probably damaging 1.00
IGL02068:Xdh APN 17 74,220,945 (GRCm39) missense probably damaging 1.00
IGL02079:Xdh APN 17 74,198,272 (GRCm39) missense probably damaging 1.00
IGL02210:Xdh APN 17 74,250,890 (GRCm39) missense probably benign 0.00
IGL02261:Xdh APN 17 74,220,960 (GRCm39) missense possibly damaging 0.81
IGL02365:Xdh APN 17 74,250,885 (GRCm39) missense probably benign 0.14
IGL02424:Xdh APN 17 74,233,565 (GRCm39) missense probably benign 0.00
IGL02491:Xdh APN 17 74,193,459 (GRCm39) missense probably damaging 0.99
IGL02525:Xdh APN 17 74,231,990 (GRCm39) missense possibly damaging 0.91
IGL02578:Xdh APN 17 74,213,241 (GRCm39) missense probably damaging 1.00
IGL02793:Xdh APN 17 74,207,576 (GRCm39) missense probably damaging 1.00
IGL02939:Xdh APN 17 74,250,840 (GRCm39) critical splice donor site probably null
IGL03327:Xdh APN 17 74,223,787 (GRCm39) missense probably benign
IGL03345:Xdh APN 17 74,213,027 (GRCm39) missense probably damaging 0.98
IGL03353:Xdh APN 17 74,202,781 (GRCm39) missense possibly damaging 0.65
inky UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
nucleus UTSW 17 74,206,007 (GRCm39) nonsense probably null
squidgame UTSW 17 74,246,831 (GRCm39) missense probably benign
R0018:Xdh UTSW 17 74,232,020 (GRCm39) missense probably benign 0.00
R0018:Xdh UTSW 17 74,232,020 (GRCm39) missense probably benign 0.00
R0033:Xdh UTSW 17 74,214,627 (GRCm39) missense probably benign 0.06
R0079:Xdh UTSW 17 74,198,213 (GRCm39) missense probably damaging 1.00
R0086:Xdh UTSW 17 74,191,433 (GRCm39) missense probably benign
R0319:Xdh UTSW 17 74,213,096 (GRCm39) splice site probably benign
R0336:Xdh UTSW 17 74,229,458 (GRCm39) missense possibly damaging 0.91
R0389:Xdh UTSW 17 74,205,357 (GRCm39) missense probably damaging 1.00
R0684:Xdh UTSW 17 74,250,886 (GRCm39) missense probably damaging 0.97
R0930:Xdh UTSW 17 74,230,077 (GRCm39) missense probably benign 0.00
R1073:Xdh UTSW 17 74,246,831 (GRCm39) missense probably benign
R1114:Xdh UTSW 17 74,248,144 (GRCm39) splice site probably benign
R1201:Xdh UTSW 17 74,225,413 (GRCm39) missense probably benign 0.05
R1230:Xdh UTSW 17 74,198,251 (GRCm39) missense probably damaging 1.00
R1351:Xdh UTSW 17 74,230,073 (GRCm39) missense probably benign 0.02
R1470:Xdh UTSW 17 74,198,107 (GRCm39) missense probably damaging 1.00
R1470:Xdh UTSW 17 74,198,107 (GRCm39) missense probably damaging 1.00
R1485:Xdh UTSW 17 74,221,014 (GRCm39) nonsense probably null
R1548:Xdh UTSW 17 74,220,896 (GRCm39) missense probably damaging 0.98
R1637:Xdh UTSW 17 74,207,573 (GRCm39) missense probably benign
R1641:Xdh UTSW 17 74,233,547 (GRCm39) missense probably benign
R1758:Xdh UTSW 17 74,217,204 (GRCm39) missense probably damaging 1.00
R1951:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R1969:Xdh UTSW 17 74,199,746 (GRCm39) missense possibly damaging 0.55
R2024:Xdh UTSW 17 74,228,300 (GRCm39) missense possibly damaging 0.92
R2080:Xdh UTSW 17 74,216,320 (GRCm39) missense probably damaging 1.00
R2157:Xdh UTSW 17 74,229,532 (GRCm39) missense probably damaging 1.00
R2300:Xdh UTSW 17 74,198,260 (GRCm39) missense probably damaging 1.00
R3783:Xdh UTSW 17 74,200,590 (GRCm39) splice site probably benign
R3796:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3797:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3798:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3799:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3819:Xdh UTSW 17 74,213,720 (GRCm39) missense probably benign 0.35
R4085:Xdh UTSW 17 74,223,874 (GRCm39) missense probably benign 0.35
R4240:Xdh UTSW 17 74,202,790 (GRCm39) missense possibly damaging 0.72
R4356:Xdh UTSW 17 74,222,685 (GRCm39) missense probably benign 0.01
R4522:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4523:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4524:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4600:Xdh UTSW 17 74,217,195 (GRCm39) missense probably benign 0.19
R4617:Xdh UTSW 17 74,225,389 (GRCm39) missense probably damaging 0.99
R4756:Xdh UTSW 17 74,193,381 (GRCm39) missense probably benign 0.24
R4761:Xdh UTSW 17 74,217,262 (GRCm39) missense possibly damaging 0.91
R4815:Xdh UTSW 17 74,213,210 (GRCm39) missense probably damaging 1.00
R4850:Xdh UTSW 17 74,205,330 (GRCm39) missense probably damaging 1.00
R4896:Xdh UTSW 17 74,217,238 (GRCm39) missense probably damaging 0.96
R4897:Xdh UTSW 17 74,207,703 (GRCm39) missense probably benign
R4923:Xdh UTSW 17 74,231,931 (GRCm39) missense possibly damaging 0.72
R4977:Xdh UTSW 17 74,205,965 (GRCm39) missense probably benign 0.05
R5030:Xdh UTSW 17 74,198,288 (GRCm39) missense probably damaging 1.00
R5185:Xdh UTSW 17 74,232,006 (GRCm39) missense probably damaging 1.00
R5347:Xdh UTSW 17 74,232,027 (GRCm39) missense probably benign
R5556:Xdh UTSW 17 74,204,759 (GRCm39) missense probably benign 0.21
R5566:Xdh UTSW 17 74,200,617 (GRCm39) missense probably damaging 1.00
R5568:Xdh UTSW 17 74,250,880 (GRCm39) missense possibly damaging 0.90
R5635:Xdh UTSW 17 74,220,870 (GRCm39) missense possibly damaging 0.92
R5662:Xdh UTSW 17 74,248,110 (GRCm39) missense probably damaging 0.99
R5955:Xdh UTSW 17 74,205,315 (GRCm39) missense probably damaging 1.00
R6058:Xdh UTSW 17 74,213,264 (GRCm39) missense probably damaging 1.00
R6061:Xdh UTSW 17 74,228,342 (GRCm39) missense probably damaging 1.00
R6412:Xdh UTSW 17 74,242,902 (GRCm39) missense probably benign 0.09
R6526:Xdh UTSW 17 74,207,546 (GRCm39) missense probably damaging 0.97
R6558:Xdh UTSW 17 74,200,708 (GRCm39) missense possibly damaging 0.95
R6843:Xdh UTSW 17 74,230,125 (GRCm39) missense probably damaging 1.00
R6932:Xdh UTSW 17 74,229,557 (GRCm39) missense probably damaging 0.99
R7028:Xdh UTSW 17 74,250,868 (GRCm39) missense probably damaging 0.99
R7418:Xdh UTSW 17 74,220,960 (GRCm39) missense possibly damaging 0.81
R7503:Xdh UTSW 17 74,233,205 (GRCm39) missense probably damaging 1.00
R7653:Xdh UTSW 17 74,204,040 (GRCm39) missense probably benign 0.10
R7763:Xdh UTSW 17 74,241,829 (GRCm39) missense possibly damaging 0.69
R7768:Xdh UTSW 17 74,246,831 (GRCm39) missense probably benign
R7904:Xdh UTSW 17 74,229,467 (GRCm39) missense probably benign 0.09
R8010:Xdh UTSW 17 74,216,312 (GRCm39) nonsense probably null
R8067:Xdh UTSW 17 74,207,652 (GRCm39) missense probably benign 0.01
R8238:Xdh UTSW 17 74,193,412 (GRCm39) missense probably benign
R8253:Xdh UTSW 17 74,225,377 (GRCm39) missense possibly damaging 0.94
R8346:Xdh UTSW 17 74,220,938 (GRCm39) missense probably damaging 1.00
R8350:Xdh UTSW 17 74,241,837 (GRCm39) missense probably damaging 1.00
R8381:Xdh UTSW 17 74,219,456 (GRCm39) missense probably benign
R8427:Xdh UTSW 17 74,242,926 (GRCm39) missense probably damaging 1.00
R8465:Xdh UTSW 17 74,206,007 (GRCm39) nonsense probably null
R8478:Xdh UTSW 17 74,213,053 (GRCm39) missense probably benign 0.00
R8802:Xdh UTSW 17 74,225,405 (GRCm39) missense probably benign 0.00
R8984:Xdh UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
R8985:Xdh UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
R8995:Xdh UTSW 17 74,205,369 (GRCm39) missense probably damaging 1.00
R9035:Xdh UTSW 17 74,217,222 (GRCm39) missense probably benign
R9149:Xdh UTSW 17 74,222,688 (GRCm39) missense probably benign
R9181:Xdh UTSW 17 74,232,006 (GRCm39) missense probably damaging 1.00
R9357:Xdh UTSW 17 74,233,541 (GRCm39) critical splice donor site probably null
R9357:Xdh UTSW 17 74,214,711 (GRCm39) missense probably damaging 0.97
R9609:Xdh UTSW 17 74,231,990 (GRCm39) missense possibly damaging 0.91
R9803:Xdh UTSW 17 74,229,455 (GRCm39) missense probably benign
X0019:Xdh UTSW 17 74,225,449 (GRCm39) missense probably damaging 1.00
Z1088:Xdh UTSW 17 74,193,423 (GRCm39) missense probably benign
Z1176:Xdh UTSW 17 74,230,037 (GRCm39) critical splice donor site probably null
Z1177:Xdh UTSW 17 74,204,690 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGCCATCTTCATGAAACTTCC -3'
(R):5'- GGTATAGACATCGTCCCAGCTC -3'

Sequencing Primer
(F):5'- ATCTTCATGAAACTTCCCAGGG -3'
(R):5'- ATCGTCCCAGCTCATGTCGAG -3'
Posted On 2021-03-08