Incidental Mutation 'R8681:Lilra5'
ID661739
Institutional Source Beutler Lab
Gene Symbol Lilra5
Ensembl Gene ENSMUSG00000070873
Gene Nameleukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5
SynonymsGm4878
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R8681 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location4237754-4243463 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4238217 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 51 (V51A)
Ref Sequence ENSEMBL: ENSMUSP00000113091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117550]
Predicted Effect probably benign
Transcript: ENSMUST00000117550
AA Change: V51A

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000113091
Gene: ENSMUSG00000070873
AA Change: V51A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 34 118 4.67e-4 SMART
IG_like 129 217 5.13e0 SMART
transmembrane domain 250 267 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family. LIR family members are known to have activating and inibitory functions in leukocytes. Crosslink of this receptor protein on the surface of monocytes has been shown to induce calcium flux and secretion of several proinflammatory cytokines, which suggests the roles of this protein in triggering innate immune responses. This gene is one of the leukocyte receptor genes that form a gene cluster on the chromosomal region 19q13.4. Four alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,190,559 F583S probably damaging Het
A430078G23Rik A G 8: 3,389,074 Y477C unknown Het
Abcc12 A G 8: 86,505,279 V1347A possibly damaging Het
Adam32 G A 8: 24,837,795 T750I unknown Het
Adcy1 T C 11: 7,161,328 I873T probably damaging Het
Aebp1 A G 11: 5,867,899 D438G probably null Het
Anks1b T A 10: 90,050,006 M188K probably damaging Het
Ccdc114 A G 7: 45,941,839 E246G probably damaging Het
Cep112 T C 11: 108,425,652 probably null Het
Clu T C 14: 65,980,957 V422A probably damaging Het
Cntrl T C 2: 35,148,588 L1050P probably damaging Het
Col23a1 A T 11: 51,567,929 T298S possibly damaging Het
Cyp26c1 A T 19: 37,686,617 T129S probably damaging Het
Cyp2c38 A C 19: 39,401,691 V355G possibly damaging Het
Cyp4a30b G A 4: 115,457,745 V175M possibly damaging Het
Cyp7a1 A T 4: 6,271,207 N316K probably benign Het
Dcaf17 T A 2: 71,056,569 Y67* probably null Het
Dll3 T C 7: 28,294,845 D389G probably damaging Het
Fbxo33 A G 12: 59,219,044 F146L probably benign Het
Gm10118 C T 10: 63,926,977 V61M unknown Het
Gm9611 T C 14: 42,296,069 D102G Het
Grik5 G A 7: 25,010,472 A946V probably benign Het
Il17c A G 8: 122,423,468 D150G possibly damaging Het
Ino80e A G 7: 126,861,721 L22P probably damaging Het
Kcnh2 G T 5: 24,331,983 T201K probably benign Het
Klrb1 A C 6: 128,710,049 N173K possibly damaging Het
Kmt2d T A 15: 98,846,067 Q3737H unknown Het
Lemd3 T C 10: 120,931,823 D682G possibly damaging Het
Lrrc25 G A 8: 70,617,664 V32I possibly damaging Het
Mdh1b T A 1: 63,715,201 M403L probably benign Het
Mms19 G A 19: 41,949,476 L765F probably damaging Het
Msx3 T A 7: 140,048,987 T5S probably benign Het
Myh13 A C 11: 67,352,134 I958L possibly damaging Het
Myo18b T A 5: 112,873,563 probably null Het
Myo9a G A 9: 59,868,111 V1002I probably benign Het
Neb T C 2: 52,237,036 K379R probably damaging Het
Nsmce2 A G 15: 59,601,359 S216G probably benign Het
Olfr1109 A T 2: 87,093,046 M117K possibly damaging Het
Olfr746 A T 14: 50,653,344 M36L probably benign Het
Pkp2 A T 16: 16,230,681 M317L probably benign Het
Pogz T A 3: 94,860,923 H137Q probably damaging Het
Prrx2 G T 2: 30,845,507 D25Y unknown Het
Ptprf T C 4: 118,231,647 D653G probably benign Het
Rps6kl1 T A 12: 85,147,855 E94V probably damaging Het
Slc44a1 A T 4: 53,481,510 D27V probably damaging Het
Slc44a4 A G 17: 34,928,277 I549V possibly damaging Het
Slc8a3 T C 12: 81,315,140 T302A probably benign Het
Spic T A 10: 88,675,985 K136N possibly damaging Het
Stk36 T C 1: 74,622,233 L473P probably damaging Het
Syce1 G A 7: 140,782,074 T32I possibly damaging Het
Tars2 G A 3: 95,750,887 Q209* probably null Het
Tmem9b A G 7: 109,745,320 V100A probably benign Het
Vmn1r67 A G 7: 10,447,201 I131V probably benign Het
Vmn2r26 C T 6: 124,024,918 T54I probably benign Het
Zfp142 T C 1: 74,571,588 E1016G probably damaging Het
Zfp773 T C 7: 7,136,483 T56A possibly damaging Het
Other mutations in Lilra5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02189:Lilra5 APN 7 4237969 missense probably benign
IGL02281:Lilra5 APN 7 4238783 missense probably benign 0.00
R0458:Lilra5 UTSW 7 4238219 missense probably benign 0.26
R0611:Lilra5 UTSW 7 4242233 missense probably benign
R0685:Lilra5 UTSW 7 4241957 splice site probably benign
R3195:Lilra5 UTSW 7 4238757 missense probably damaging 0.96
R4726:Lilra5 UTSW 7 4237958 missense probably benign 0.00
R4745:Lilra5 UTSW 7 4242077 missense possibly damaging 0.72
R4836:Lilra5 UTSW 7 4238714 missense possibly damaging 0.71
R6034:Lilra5 UTSW 7 4242134 missense probably benign 0.33
R6034:Lilra5 UTSW 7 4242134 missense probably benign 0.33
R6263:Lilra5 UTSW 7 4238361 missense probably damaging 1.00
R6266:Lilra5 UTSW 7 4241928 missense possibly damaging 0.84
R6285:Lilra5 UTSW 7 4242115 missense probably damaging 1.00
R6292:Lilra5 UTSW 7 4238339 missense possibly damaging 0.81
R6344:Lilra5 UTSW 7 4238786 missense probably damaging 1.00
R6861:Lilra5 UTSW 7 4241932 missense probably benign 0.14
R8353:Lilra5 UTSW 7 4237972 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GGGCTCGAGAACATCAGATG -3'
(R):5'- GGACTGAGTGTTCTCTCACCTG -3'

Sequencing Primer
(F):5'- GGCTCGAGAACATCAGATGATACC -3'
(R):5'- TGTCACTGCAAGCTCTAGAGG -3'
Posted On2021-03-08