Mutagenetix > Incidental Mutation

Incidental Mutation 'R8681:Grik5'

661742

Institutional Source

Beutler Lab

Gene Symbol

Grik5

Ensembl Gene

ENSMUSG00000003378

Gene Name

glutamate receptor, ionotropic, kainate 5 (gamma 2)

Synonyms

GluRgamma2, KA2

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.226) question?

Stock #

R8681 (G1)

Quality Score

90.0077

Status

Not validated

Chromosome

Chromosomal Location

25009849-25072346 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 25010472 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 946 (A946V)

Ref Sequence

ENSEMBL: ENSMUSP00000003468 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003468] [ENSMUST00000080882] [ENSMUST00000102858] [ENSMUST00000196684] [ENSMUST00000205328] [ENSMUST00000206134]

AlphaFold

Q61626

Predicted Effect

probably benign
Transcript: ENSMUST00000003468
AA Change: A946V

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000003468
Gene: ENSMUSG00000003378
AA Change: A946V

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	40	381	3.4e-64	PFAM
PBPe	416	785	3.7e-122	SMART
Lig_chan-Glu_bd	426	490	1.65e-29	SMART
transmembrane domain	804	823	N/A	INTRINSIC
low complexity region	859	872	N/A	INTRINSIC
low complexity region	893	921	N/A	INTRINSIC
low complexity region	962	973	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000080882

SMART Domains

Protein: ENSMUSP00000079691
Gene: ENSMUSG00000040907

Domain	Start	End	E-Value	Type
low complexity region	3	17	N/A	INTRINSIC
Cation_ATPase_N	32	106	2.41e-22	SMART
Pfam:E1-E2_ATPase	125	356	6.3e-64	PFAM
Pfam:Hydrolase	360	719	2.6e-32	PFAM
Pfam:HAD	363	716	4.7e-18	PFAM
Pfam:Hydrolase_like2	416	511	5.7e-26	PFAM
Pfam:Cation_ATPase_C	789	998	3.5e-46	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000102858

SMART Domains

Protein: ENSMUSP00000099922
Gene: ENSMUSG00000040907

Domain	Start	End	E-Value	Type
low complexity region	3	17	N/A	INTRINSIC
Cation_ATPase_N	32	106	2.41e-22	SMART
Pfam:E1-E2_ATPase	124	355	4.6e-60	PFAM
Pfam:Hydrolase	360	719	5.7e-20	PFAM
Pfam:HAD	363	716	4.5e-19	PFAM
Pfam:Cation_ATPase	416	511	5.1e-25	PFAM
Pfam:Cation_ATPase_C	789	998	1.4e-46	PFAM
low complexity region	1030	1047	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000196684

SMART Domains

Protein: ENSMUSP00000143735
Gene: ENSMUSG00000040907

Domain	Start	End	E-Value	Type
low complexity region	16	30	N/A	INTRINSIC
Cation_ATPase_N	45	119	1.9e-26	SMART
Pfam:E1-E2_ATPase	137	368	4e-58	PFAM
Pfam:Hydrolase	373	732	3.8e-18	PFAM
Pfam:HAD	376	729	3.8e-17	PFAM
Pfam:Cation_ATPase	429	524	5.2e-23	PFAM
Pfam:Cation_ATPase_C	802	1011	2.5e-44	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000205328

Predicted Effect

probably benign
Transcript: ENSMUST00000206134

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the glutamate-gated ionic channel family. Glutamate functions as the major excitatory neurotransmitter in the central nervous system through activation of ligand-gated ion channels and G protein-coupled membrane receptors. The protein encoded by this gene forms functional heteromeric kainate-preferring ionic channels with the subunits encoded by related gene family members. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for one allele display abnormal hippocampal synapse function. Mice homozygous for a second allele display decreased thermal nociception, increased startle response and increased susceptibility to pharmacologically induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	T	C	13: 63,190,559	F583S	probably damaging	Het
A430078G23Rik	A	G	8: 3,389,074	Y477C	unknown	Het
Abcc12	A	G	8: 86,505,279	V1347A	possibly damaging	Het
Adam32	G	A	8: 24,837,795	T750I	unknown	Het
Adcy1	T	C	11: 7,161,328	I873T	probably damaging	Het
Aebp1	A	G	11: 5,867,899	D438G	probably null	Het
Anks1b	T	A	10: 90,050,006	M188K	probably damaging	Het
Ccdc114	A	G	7: 45,941,839	E246G	probably damaging	Het
Cep112	T	C	11: 108,425,652		probably null	Het
Clu	T	C	14: 65,980,957	V422A	probably damaging	Het
Cntrl	T	C	2: 35,148,588	L1050P	probably damaging	Het
Col23a1	A	T	11: 51,567,929	T298S	possibly damaging	Het
Cyp26c1	A	T	19: 37,686,617	T129S	probably damaging	Het
Cyp2c38	A	C	19: 39,401,691	V355G	possibly damaging	Het
Cyp4a30b	G	A	4: 115,457,745	V175M	possibly damaging	Het
Cyp7a1	A	T	4: 6,271,207	N316K	probably benign	Het
Dcaf17	T	A	2: 71,056,569	Y67*	probably null	Het
Dll3	T	C	7: 28,294,845	D389G	probably damaging	Het
Fbxo33	A	G	12: 59,219,044	F146L	probably benign	Het
Gm10118	C	T	10: 63,926,977	V61M	unknown	Het
Gm9611	T	C	14: 42,296,069	D102G		Het
Il17c	A	G	8: 122,423,468	D150G	possibly damaging	Het
Ino80e	A	G	7: 126,861,721	L22P	probably damaging	Het
Kcnh2	G	T	5: 24,331,983	T201K	probably benign	Het
Klrb1	A	C	6: 128,710,049	N173K	possibly damaging	Het
Kmt2d	T	A	15: 98,846,067	Q3737H	unknown	Het
Lemd3	T	C	10: 120,931,823	D682G	possibly damaging	Het
Lilra5	T	C	7: 4,238,217	V51A	probably benign	Het
Lrrc25	G	A	8: 70,617,664	V32I	possibly damaging	Het
Mdh1b	T	A	1: 63,715,201	M403L	probably benign	Het
Mms19	G	A	19: 41,949,476	L765F	probably damaging	Het
Msx3	T	A	7: 140,048,987	T5S	probably benign	Het
Myh13	A	C	11: 67,352,134	I958L	possibly damaging	Het
Myo18b	T	A	5: 112,873,563		probably null	Het
Myo9a	G	A	9: 59,868,111	V1002I	probably benign	Het
Neb	T	C	2: 52,237,036	K379R	probably damaging	Het
Nsmce2	A	G	15: 59,601,359	S216G	probably benign	Het
Olfr1109	A	T	2: 87,093,046	M117K	possibly damaging	Het
Olfr746	A	T	14: 50,653,344	M36L	probably benign	Het
Pkp2	A	T	16: 16,230,681	M317L	probably benign	Het
Pogz	T	A	3: 94,860,923	H137Q	probably damaging	Het
Prrx2	G	T	2: 30,845,507	D25Y	unknown	Het
Ptprf	T	C	4: 118,231,647	D653G	probably benign	Het
Rps6kl1	T	A	12: 85,147,855	E94V	probably damaging	Het
Slc44a1	A	T	4: 53,481,510	D27V	probably damaging	Het
Slc44a4	A	G	17: 34,928,277	I549V	possibly damaging	Het
Slc8a3	T	C	12: 81,315,140	T302A	probably benign	Het
Spic	T	A	10: 88,675,985	K136N	possibly damaging	Het
Stk36	T	C	1: 74,622,233	L473P	probably damaging	Het
Syce1	G	A	7: 140,782,074	T32I	possibly damaging	Het
Tars2	G	A	3: 95,750,887	Q209*	probably null	Het
Tmem9b	A	G	7: 109,745,320	V100A	probably benign	Het
Vmn1r67	A	G	7: 10,447,201	I131V	probably benign	Het
Vmn2r26	C	T	6: 124,024,918	T54I	probably benign	Het
Zfp142	T	C	1: 74,571,588	E1016G	probably damaging	Het
Zfp773	T	C	7: 7,136,483	T56A	possibly damaging	Het

Other mutations in Grik5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00788:Grik5	APN	7	25065393	missense	probably damaging	1.00
IGL00974:Grik5	APN	7	25013885	missense	probably damaging	1.00
IGL01941:Grik5	APN	7	25065182	missense	probably damaging	1.00
IGL02642:Grik5	APN	7	25058983	missense	possibly damaging	0.51
IGL03177:Grik5	APN	7	25015454	missense	probably damaging	1.00
IGL03402:Grik5	APN	7	25015469	missense	probably damaging	1.00
Griffin	UTSW	7	25059077	missense	possibly damaging	0.78
G1citation:Grik5	UTSW	7	25046355	missense	possibly damaging	0.46
PIT4453001:Grik5	UTSW	7	25010694	missense	probably damaging	0.99
R0077:Grik5	UTSW	7	25023380	missense	probably damaging	1.00
R0412:Grik5	UTSW	7	25013674	missense	possibly damaging	0.59
R0427:Grik5	UTSW	7	25058498	missense	probably benign	0.34
R1191:Grik5	UTSW	7	25058325	nonsense	probably null
R1830:Grik5	UTSW	7	25046301	missense	possibly damaging	0.94
R2072:Grik5	UTSW	7	25015313	missense	possibly damaging	0.92
R2369:Grik5	UTSW	7	25058537	missense	probably damaging	1.00
R3410:Grik5	UTSW	7	25062972	missense	probably benign	0.04
R3411:Grik5	UTSW	7	25062972	missense	probably benign	0.04
R3615:Grik5	UTSW	7	25022571	missense	probably benign	0.37
R3616:Grik5	UTSW	7	25022571	missense	probably benign	0.37
R4600:Grik5	UTSW	7	25068064	missense	probably damaging	0.99
R4658:Grik5	UTSW	7	25060727	splice site	probably benign
R4735:Grik5	UTSW	7	25058288	missense	probably damaging	1.00
R4810:Grik5	UTSW	7	25015497	missense	probably damaging	0.98
R5113:Grik5	UTSW	7	25015527	missense	probably damaging	1.00
R5120:Grik5	UTSW	7	25010640	missense	probably damaging	1.00
R5132:Grik5	UTSW	7	25065204	missense	probably benign	0.02
R5173:Grik5	UTSW	7	25062894	missense	possibly damaging	0.76
R5186:Grik5	UTSW	7	25015819	missense	probably damaging	1.00
R5239:Grik5	UTSW	7	25065470	missense	probably damaging	1.00
R5935:Grik5	UTSW	7	25059077	missense	possibly damaging	0.78
R6335:Grik5	UTSW	7	25013594	missense	probably benign
R6609:Grik5	UTSW	7	25015526	nonsense	probably null
R6760:Grik5	UTSW	7	25058939	critical splice donor site	probably null
R6820:Grik5	UTSW	7	25046355	missense	possibly damaging	0.46
R6821:Grik5	UTSW	7	25046355	missense	possibly damaging	0.46
R6822:Grik5	UTSW	7	25046355	missense	possibly damaging	0.46
R6824:Grik5	UTSW	7	25046355	missense	possibly damaging	0.46
R7173:Grik5	UTSW	7	25068162	missense	probably damaging	1.00
R7230:Grik5	UTSW	7	25023070	missense	probably damaging	1.00
R7555:Grik5	UTSW	7	25060597	missense	probably benign
R7560:Grik5	UTSW	7	25058526	missense	probably damaging	0.99
R7571:Grik5	UTSW	7	25013885	missense	possibly damaging	0.87
R8228:Grik5	UTSW	7	25010508	missense	probably damaging	1.00
R8228:Grik5	UTSW	7	25046310	missense	possibly damaging	0.93
R8879:Grik5	UTSW	7	25023064	missense	possibly damaging	0.95
R8933:Grik5	UTSW	7	25023318	missense	probably benign	0.11
R9129:Grik5	UTSW	7	25068004	splice site	probably benign
R9130:Grik5	UTSW	7	25068004	splice site	probably benign
R9154:Grik5	UTSW	7	25058978	missense	probably damaging	1.00
R9317:Grik5	UTSW	7	25046235	missense	probably damaging	0.99
R9355:Grik5	UTSW	7	25068172	missense	possibly damaging	0.82
R9406:Grik5	UTSW	7	25058544	missense	probably benign	0.00
X0017:Grik5	UTSW	7	25060588	missense	probably damaging	1.00
Z1176:Grik5	UTSW	7	25013804	missense	probably damaging	0.98
Z1177:Grik5	UTSW	7	25015825	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTGCTCAAGTCCACTAGGAGG -3'
(R):5'- TCAGCAACGGCAAGCTCTAC -3'

Sequencing Primer
(F):5'- TCGGACTTCACCAGGAATTG -3'
(R):5'- AACGGCAAGCTCTACTCGGC -3'

Posted On

2021-03-08