Incidental Mutation 'R8681:Slc8a3'
ID661765
Institutional Source Beutler Lab
Gene Symbol Slc8a3
Ensembl Gene ENSMUSG00000079055
Gene Namesolute carrier family 8 (sodium/calcium exchanger), member 3
SynonymsNcx3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8681 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location81197915-81333180 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81315140 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 302 (T302A)
Ref Sequence ENSEMBL: ENSMUSP00000138735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064594] [ENSMUST00000085238] [ENSMUST00000182208]
Predicted Effect
SMART Domains Protein: ENSMUSP00000063258
Gene: ENSMUSG00000079055
AA Change: T302A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 79 250 1.3e-36 PFAM
Pfam:Na_Ca_ex_C 253 379 4.6e-57 PFAM
Calx_beta 385 485 3.25e-42 SMART
Calx_beta 519 619 1.04e-40 SMART
low complexity region 712 723 N/A INTRINSIC
Pfam:Na_Ca_ex 754 919 2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085238
AA Change: T302A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000082334
Gene: ENSMUSG00000079055
AA Change: T302A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 79 250 1.3e-36 PFAM
Pfam:Na_Ca_ex_C 253 379 4.6e-57 PFAM
Calx_beta 385 485 3.25e-42 SMART
Calx_beta 519 619 1.54e-43 SMART
low complexity region 705 716 N/A INTRINSIC
Pfam:Na_Ca_ex 747 912 1.9e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182208
AA Change: T302A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138735
Gene: ENSMUSG00000079055
AA Change: T302A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 89 248 8.1e-38 PFAM
Calx_beta 385 485 3.25e-42 SMART
Calx_beta 519 619 1.04e-40 SMART
low complexity region 712 723 N/A INTRINSIC
Pfam:Na_Ca_ex 764 917 9.1e-27 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium/calcium exchanger integral membrane protein family. Na+/Ca2+ exchange proteins are involved in maintaining Ca2+ homeostasis in a wide variety of cell types. The protein is regulated by intracellular calcium ions and is found in both the plasma membrane and intracellular organellar membranes, where exchange of Na+ for Ca2+ occurs in an electrogenic manner. Alternative splicing has been observed for this gene and multiple variants have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,190,559 F583S probably damaging Het
A430078G23Rik A G 8: 3,389,074 Y477C unknown Het
Abcc12 A G 8: 86,505,279 V1347A possibly damaging Het
Adam32 G A 8: 24,837,795 T750I unknown Het
Adcy1 T C 11: 7,161,328 I873T probably damaging Het
Aebp1 A G 11: 5,867,899 D438G probably null Het
Anks1b T A 10: 90,050,006 M188K probably damaging Het
Ccdc114 A G 7: 45,941,839 E246G probably damaging Het
Cep112 T C 11: 108,425,652 probably null Het
Clu T C 14: 65,980,957 V422A probably damaging Het
Cntrl T C 2: 35,148,588 L1050P probably damaging Het
Col23a1 A T 11: 51,567,929 T298S possibly damaging Het
Cyp26c1 A T 19: 37,686,617 T129S probably damaging Het
Cyp2c38 A C 19: 39,401,691 V355G possibly damaging Het
Cyp4a30b G A 4: 115,457,745 V175M possibly damaging Het
Cyp7a1 A T 4: 6,271,207 N316K probably benign Het
Dcaf17 T A 2: 71,056,569 Y67* probably null Het
Dll3 T C 7: 28,294,845 D389G probably damaging Het
Fbxo33 A G 12: 59,219,044 F146L probably benign Het
Gm10118 C T 10: 63,926,977 V61M unknown Het
Gm9611 T C 14: 42,296,069 D102G Het
Grik5 G A 7: 25,010,472 A946V probably benign Het
Il17c A G 8: 122,423,468 D150G possibly damaging Het
Ino80e A G 7: 126,861,721 L22P probably damaging Het
Kcnh2 G T 5: 24,331,983 T201K probably benign Het
Klrb1 A C 6: 128,710,049 N173K possibly damaging Het
Kmt2d T A 15: 98,846,067 Q3737H unknown Het
Lemd3 T C 10: 120,931,823 D682G possibly damaging Het
Lilra5 T C 7: 4,238,217 V51A probably benign Het
Lrrc25 G A 8: 70,617,664 V32I possibly damaging Het
Mdh1b T A 1: 63,715,201 M403L probably benign Het
Mms19 G A 19: 41,949,476 L765F probably damaging Het
Msx3 T A 7: 140,048,987 T5S probably benign Het
Myh13 A C 11: 67,352,134 I958L possibly damaging Het
Myo18b T A 5: 112,873,563 probably null Het
Myo9a G A 9: 59,868,111 V1002I probably benign Het
Neb T C 2: 52,237,036 K379R probably damaging Het
Nsmce2 A G 15: 59,601,359 S216G probably benign Het
Olfr1109 A T 2: 87,093,046 M117K possibly damaging Het
Olfr746 A T 14: 50,653,344 M36L probably benign Het
Pkp2 A T 16: 16,230,681 M317L probably benign Het
Pogz T A 3: 94,860,923 H137Q probably damaging Het
Prrx2 G T 2: 30,845,507 D25Y unknown Het
Ptprf T C 4: 118,231,647 D653G probably benign Het
Rps6kl1 T A 12: 85,147,855 E94V probably damaging Het
Slc44a1 A T 4: 53,481,510 D27V probably damaging Het
Slc44a4 A G 17: 34,928,277 I549V possibly damaging Het
Spic T A 10: 88,675,985 K136N possibly damaging Het
Stk36 T C 1: 74,622,233 L473P probably damaging Het
Syce1 G A 7: 140,782,074 T32I possibly damaging Het
Tars2 G A 3: 95,750,887 Q209* probably null Het
Tmem9b A G 7: 109,745,320 V100A probably benign Het
Vmn1r67 A G 7: 10,447,201 I131V probably benign Het
Vmn2r26 C T 6: 124,024,918 T54I probably benign Het
Zfp142 T C 1: 74,571,588 E1016G probably damaging Het
Zfp773 T C 7: 7,136,483 T56A possibly damaging Het
Other mutations in Slc8a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Slc8a3 APN 12 81314569 missense probably benign
IGL01315:Slc8a3 APN 12 81314395 missense probably damaging 0.97
IGL01365:Slc8a3 APN 12 81315376 missense probably damaging 0.99
IGL01610:Slc8a3 APN 12 81315802 missense probably damaging 1.00
IGL02227:Slc8a3 APN 12 81315683 missense probably damaging 1.00
IGL02299:Slc8a3 APN 12 81315224 missense probably damaging 0.98
IGL02548:Slc8a3 APN 12 81204156 splice site probably benign
IGL02646:Slc8a3 APN 12 81315094 missense probably damaging 1.00
IGL03135:Slc8a3 APN 12 81202249 missense probably damaging 1.00
R0050:Slc8a3 UTSW 12 81315265 missense probably damaging 1.00
R0627:Slc8a3 UTSW 12 81314842 missense probably damaging 1.00
R0648:Slc8a3 UTSW 12 81314446 missense probably damaging 1.00
R1342:Slc8a3 UTSW 12 81316016 missense probably damaging 0.99
R1437:Slc8a3 UTSW 12 81315986 missense probably damaging 0.99
R1470:Slc8a3 UTSW 12 81199710 missense probably benign
R1470:Slc8a3 UTSW 12 81199710 missense probably benign
R1557:Slc8a3 UTSW 12 81315557 missense probably damaging 1.00
R1563:Slc8a3 UTSW 12 81205007 missense possibly damaging 0.47
R1918:Slc8a3 UTSW 12 81314844 missense probably damaging 0.99
R1930:Slc8a3 UTSW 12 81314446 missense probably damaging 1.00
R1931:Slc8a3 UTSW 12 81314446 missense probably damaging 1.00
R2232:Slc8a3 UTSW 12 81315220 missense probably damaging 0.99
R2680:Slc8a3 UTSW 12 81202339 missense probably damaging 0.99
R2941:Slc8a3 UTSW 12 81315179 missense probably damaging 1.00
R3157:Slc8a3 UTSW 12 81314992 missense probably damaging 1.00
R3159:Slc8a3 UTSW 12 81314992 missense probably damaging 1.00
R3751:Slc8a3 UTSW 12 81204138 missense probably damaging 1.00
R3859:Slc8a3 UTSW 12 81314872 missense probably damaging 0.99
R4240:Slc8a3 UTSW 12 81315176 missense probably damaging 0.99
R4527:Slc8a3 UTSW 12 81315853 missense probably damaging 1.00
R4547:Slc8a3 UTSW 12 81314851 missense possibly damaging 0.76
R4951:Slc8a3 UTSW 12 81314699 missense probably benign 0.31
R4951:Slc8a3 UTSW 12 81315986 missense probably damaging 0.99
R5022:Slc8a3 UTSW 12 81199558 missense probably damaging 0.96
R5049:Slc8a3 UTSW 12 81214132 missense probably damaging 1.00
R5057:Slc8a3 UTSW 12 81199558 missense probably damaging 0.96
R5104:Slc8a3 UTSW 12 81214134 missense probably null 0.34
R5122:Slc8a3 UTSW 12 81314258 critical splice donor site probably null
R5183:Slc8a3 UTSW 12 81314491 missense possibly damaging 0.79
R5629:Slc8a3 UTSW 12 81199631 missense probably damaging 1.00
R6062:Slc8a3 UTSW 12 81314350 missense probably damaging 1.00
R6218:Slc8a3 UTSW 12 81199567 missense probably benign
R6279:Slc8a3 UTSW 12 81314978 missense probably damaging 0.99
R6300:Slc8a3 UTSW 12 81314978 missense probably damaging 0.99
R6416:Slc8a3 UTSW 12 81315627 missense probably damaging 1.00
R6790:Slc8a3 UTSW 12 81314432 missense probably benign 0.00
R6999:Slc8a3 UTSW 12 81314755 missense probably benign 0.06
R7195:Slc8a3 UTSW 12 81314273 missense possibly damaging 0.95
R7268:Slc8a3 UTSW 12 81315053 missense probably damaging 0.98
R7288:Slc8a3 UTSW 12 81216824 missense possibly damaging 0.70
R7383:Slc8a3 UTSW 12 81315805 missense probably damaging 1.00
R7392:Slc8a3 UTSW 12 81314803 missense probably damaging 0.99
R7394:Slc8a3 UTSW 12 81214058 splice site probably null
R7549:Slc8a3 UTSW 12 81314770 missense probably benign 0.06
R7657:Slc8a3 UTSW 12 81314384 missense probably damaging 1.00
R7699:Slc8a3 UTSW 12 81314473 missense probably damaging 1.00
R7759:Slc8a3 UTSW 12 81314551 missense probably benign
R7960:Slc8a3 UTSW 12 81216732 missense probably benign 0.00
R7985:Slc8a3 UTSW 12 81314993 missense probably damaging 1.00
R8059:Slc8a3 UTSW 12 81202258 missense probably damaging 1.00
R8192:Slc8a3 UTSW 12 81199681 missense probably damaging 1.00
R8397:Slc8a3 UTSW 12 81199768 missense probably benign 0.45
R8413:Slc8a3 UTSW 12 81314678 missense probably damaging 0.97
X0026:Slc8a3 UTSW 12 81315287 missense probably benign 0.22
X0028:Slc8a3 UTSW 12 81314943 missense probably damaging 1.00
Z1177:Slc8a3 UTSW 12 81314700 missense possibly damaging 0.92
Z1177:Slc8a3 UTSW 12 81315876 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TATTGCCCGCACCAGTCATC -3'
(R):5'- TTGGGAAGGCCTCCTTACTC -3'

Sequencing Primer
(F):5'- ACCAGTCATCATCCGGGTG -3'
(R):5'- GGGAAGGCCTCCTTACTCTCTTC -3'
Posted On2021-03-08