Incidental Mutation 'R8681:Slc8a3'
ID 661765
Institutional Source Beutler Lab
Gene Symbol Slc8a3
Ensembl Gene ENSMUSG00000079055
Gene Name solute carrier family 8 (sodium/calcium exchanger), member 3
Synonyms Ncx3
MMRRC Submission 068536-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8681 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 81244689-81379954 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 81361914 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 302 (T302A)
Ref Sequence ENSEMBL: ENSMUSP00000138735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064594] [ENSMUST00000085238] [ENSMUST00000182208]
AlphaFold S4R2P9
Predicted Effect
SMART Domains Protein: ENSMUSP00000063258
Gene: ENSMUSG00000079055
AA Change: T302A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 79 250 1.3e-36 PFAM
Pfam:Na_Ca_ex_C 253 379 4.6e-57 PFAM
Calx_beta 385 485 3.25e-42 SMART
Calx_beta 519 619 1.04e-40 SMART
low complexity region 712 723 N/A INTRINSIC
Pfam:Na_Ca_ex 754 919 2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085238
AA Change: T302A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000082334
Gene: ENSMUSG00000079055
AA Change: T302A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 79 250 1.3e-36 PFAM
Pfam:Na_Ca_ex_C 253 379 4.6e-57 PFAM
Calx_beta 385 485 3.25e-42 SMART
Calx_beta 519 619 1.54e-43 SMART
low complexity region 705 716 N/A INTRINSIC
Pfam:Na_Ca_ex 747 912 1.9e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182208
AA Change: T302A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138735
Gene: ENSMUSG00000079055
AA Change: T302A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 89 248 8.1e-38 PFAM
Calx_beta 385 485 3.25e-42 SMART
Calx_beta 519 619 1.04e-40 SMART
low complexity region 712 723 N/A INTRINSIC
Pfam:Na_Ca_ex 764 917 9.1e-27 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium/calcium exchanger integral membrane protein family. Na+/Ca2+ exchange proteins are involved in maintaining Ca2+ homeostasis in a wide variety of cell types. The protein is regulated by intracellular calcium ions and is found in both the plasma membrane and intracellular organellar membranes, where exchange of Na+ for Ca2+ occurs in an electrogenic manner. Alternative splicing has been observed for this gene and multiple variants have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 A G 8: 87,231,908 (GRCm39) V1347A possibly damaging Het
Adam32 G A 8: 25,327,811 (GRCm39) T750I unknown Het
Adcy1 T C 11: 7,111,328 (GRCm39) I873T probably damaging Het
Aebp1 A G 11: 5,817,899 (GRCm39) D438G probably null Het
Anks1b T A 10: 89,885,868 (GRCm39) M188K probably damaging Het
Aopep T C 13: 63,338,373 (GRCm39) F583S probably damaging Het
Arhgef18 A G 8: 3,439,074 (GRCm39) Y477C unknown Het
Cep112 T C 11: 108,316,478 (GRCm39) probably null Het
Clu T C 14: 66,218,406 (GRCm39) V422A probably damaging Het
Cntrl T C 2: 35,038,600 (GRCm39) L1050P probably damaging Het
Col23a1 A T 11: 51,458,756 (GRCm39) T298S possibly damaging Het
Cyp26c1 A T 19: 37,675,065 (GRCm39) T129S probably damaging Het
Cyp2c38 A C 19: 39,390,135 (GRCm39) V355G possibly damaging Het
Cyp4a30b G A 4: 115,314,942 (GRCm39) V175M possibly damaging Het
Cyp7a1 A T 4: 6,271,207 (GRCm39) N316K probably benign Het
Dcaf17 T A 2: 70,886,913 (GRCm39) Y67* probably null Het
Dll3 T C 7: 27,994,270 (GRCm39) D389G probably damaging Het
Fbxo33 A G 12: 59,265,830 (GRCm39) F146L probably benign Het
Gm10118 C T 10: 63,762,756 (GRCm39) V61M unknown Het
Gm9611 T C 14: 42,118,026 (GRCm39) D102G Het
Grik5 G A 7: 24,709,897 (GRCm39) A946V probably benign Het
Il17c A G 8: 123,150,207 (GRCm39) D150G possibly damaging Het
Ino80e A G 7: 126,460,893 (GRCm39) L22P probably damaging Het
Kcnh2 G T 5: 24,536,981 (GRCm39) T201K probably benign Het
Klrb1 A C 6: 128,687,012 (GRCm39) N173K possibly damaging Het
Kmt2d T A 15: 98,743,948 (GRCm39) Q3737H unknown Het
Lemd3 T C 10: 120,767,728 (GRCm39) D682G possibly damaging Het
Lilra5 T C 7: 4,241,216 (GRCm39) V51A probably benign Het
Lrrc25 G A 8: 71,070,314 (GRCm39) V32I possibly damaging Het
Mdh1b T A 1: 63,754,360 (GRCm39) M403L probably benign Het
Mms19 G A 19: 41,937,915 (GRCm39) L765F probably damaging Het
Msx3 T A 7: 139,628,900 (GRCm39) T5S probably benign Het
Myh13 A C 11: 67,242,960 (GRCm39) I958L possibly damaging Het
Myo18b T A 5: 113,021,429 (GRCm39) probably null Het
Myo9a G A 9: 59,775,394 (GRCm39) V1002I probably benign Het
Neb T C 2: 52,127,048 (GRCm39) K379R probably damaging Het
Nsmce2 A G 15: 59,473,208 (GRCm39) S216G probably benign Het
Odad1 A G 7: 45,591,263 (GRCm39) E246G probably damaging Het
Or11h7 A T 14: 50,890,801 (GRCm39) M36L probably benign Het
Or5aq6 A T 2: 86,923,390 (GRCm39) M117K possibly damaging Het
Pkp2 A T 16: 16,048,545 (GRCm39) M317L probably benign Het
Pogz T A 3: 94,768,234 (GRCm39) H137Q probably damaging Het
Prrx2 G T 2: 30,735,519 (GRCm39) D25Y unknown Het
Ptprf T C 4: 118,088,844 (GRCm39) D653G probably benign Het
Rps6kl1 T A 12: 85,194,629 (GRCm39) E94V probably damaging Het
Slc44a1 A T 4: 53,481,510 (GRCm39) D27V probably damaging Het
Slc44a4 A G 17: 35,147,253 (GRCm39) I549V possibly damaging Het
Spic T A 10: 88,511,847 (GRCm39) K136N possibly damaging Het
Stk36 T C 1: 74,661,392 (GRCm39) L473P probably damaging Het
Syce1 G A 7: 140,361,987 (GRCm39) T32I possibly damaging Het
Tars2 G A 3: 95,658,199 (GRCm39) Q209* probably null Het
Tmem9b A G 7: 109,344,527 (GRCm39) V100A probably benign Het
Vmn1r67 A G 7: 10,181,128 (GRCm39) I131V probably benign Het
Vmn2r26 C T 6: 124,001,877 (GRCm39) T54I probably benign Het
Zfp142 T C 1: 74,610,747 (GRCm39) E1016G probably damaging Het
Zfp773 T C 7: 7,139,482 (GRCm39) T56A possibly damaging Het
Other mutations in Slc8a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Slc8a3 APN 12 81,361,343 (GRCm39) missense probably benign
IGL01315:Slc8a3 APN 12 81,361,169 (GRCm39) missense probably damaging 0.97
IGL01365:Slc8a3 APN 12 81,362,150 (GRCm39) missense probably damaging 0.99
IGL01610:Slc8a3 APN 12 81,362,576 (GRCm39) missense probably damaging 1.00
IGL02227:Slc8a3 APN 12 81,362,457 (GRCm39) missense probably damaging 1.00
IGL02299:Slc8a3 APN 12 81,361,998 (GRCm39) missense probably damaging 0.98
IGL02548:Slc8a3 APN 12 81,250,930 (GRCm39) splice site probably benign
IGL02646:Slc8a3 APN 12 81,361,868 (GRCm39) missense probably damaging 1.00
IGL03135:Slc8a3 APN 12 81,249,023 (GRCm39) missense probably damaging 1.00
R0050:Slc8a3 UTSW 12 81,362,039 (GRCm39) missense probably damaging 1.00
R0627:Slc8a3 UTSW 12 81,361,616 (GRCm39) missense probably damaging 1.00
R0648:Slc8a3 UTSW 12 81,361,220 (GRCm39) missense probably damaging 1.00
R1342:Slc8a3 UTSW 12 81,362,790 (GRCm39) missense probably damaging 0.99
R1437:Slc8a3 UTSW 12 81,362,760 (GRCm39) missense probably damaging 0.99
R1470:Slc8a3 UTSW 12 81,246,484 (GRCm39) missense probably benign
R1470:Slc8a3 UTSW 12 81,246,484 (GRCm39) missense probably benign
R1557:Slc8a3 UTSW 12 81,362,331 (GRCm39) missense probably damaging 1.00
R1563:Slc8a3 UTSW 12 81,251,781 (GRCm39) missense possibly damaging 0.47
R1918:Slc8a3 UTSW 12 81,361,618 (GRCm39) missense probably damaging 0.99
R1930:Slc8a3 UTSW 12 81,361,220 (GRCm39) missense probably damaging 1.00
R1931:Slc8a3 UTSW 12 81,361,220 (GRCm39) missense probably damaging 1.00
R2232:Slc8a3 UTSW 12 81,361,994 (GRCm39) missense probably damaging 0.99
R2680:Slc8a3 UTSW 12 81,249,113 (GRCm39) missense probably damaging 0.99
R2941:Slc8a3 UTSW 12 81,361,953 (GRCm39) missense probably damaging 1.00
R3157:Slc8a3 UTSW 12 81,361,766 (GRCm39) missense probably damaging 1.00
R3159:Slc8a3 UTSW 12 81,361,766 (GRCm39) missense probably damaging 1.00
R3751:Slc8a3 UTSW 12 81,250,912 (GRCm39) missense probably damaging 1.00
R3859:Slc8a3 UTSW 12 81,361,646 (GRCm39) missense probably damaging 0.99
R4240:Slc8a3 UTSW 12 81,361,950 (GRCm39) missense probably damaging 0.99
R4527:Slc8a3 UTSW 12 81,362,627 (GRCm39) missense probably damaging 1.00
R4547:Slc8a3 UTSW 12 81,361,625 (GRCm39) missense possibly damaging 0.76
R4951:Slc8a3 UTSW 12 81,362,760 (GRCm39) missense probably damaging 0.99
R4951:Slc8a3 UTSW 12 81,361,473 (GRCm39) missense probably benign 0.31
R5022:Slc8a3 UTSW 12 81,246,332 (GRCm39) missense probably damaging 0.96
R5049:Slc8a3 UTSW 12 81,260,906 (GRCm39) missense probably damaging 1.00
R5057:Slc8a3 UTSW 12 81,246,332 (GRCm39) missense probably damaging 0.96
R5104:Slc8a3 UTSW 12 81,260,908 (GRCm39) missense probably null 0.34
R5122:Slc8a3 UTSW 12 81,361,032 (GRCm39) critical splice donor site probably null
R5183:Slc8a3 UTSW 12 81,361,265 (GRCm39) missense possibly damaging 0.79
R5629:Slc8a3 UTSW 12 81,246,405 (GRCm39) missense probably damaging 1.00
R6062:Slc8a3 UTSW 12 81,361,124 (GRCm39) missense probably damaging 1.00
R6218:Slc8a3 UTSW 12 81,246,341 (GRCm39) missense probably benign
R6279:Slc8a3 UTSW 12 81,361,752 (GRCm39) missense probably damaging 0.99
R6300:Slc8a3 UTSW 12 81,361,752 (GRCm39) missense probably damaging 0.99
R6416:Slc8a3 UTSW 12 81,362,401 (GRCm39) missense probably damaging 1.00
R6790:Slc8a3 UTSW 12 81,361,206 (GRCm39) missense probably benign 0.00
R6999:Slc8a3 UTSW 12 81,361,529 (GRCm39) missense probably benign 0.06
R7195:Slc8a3 UTSW 12 81,361,047 (GRCm39) missense possibly damaging 0.95
R7268:Slc8a3 UTSW 12 81,361,827 (GRCm39) missense probably damaging 0.98
R7288:Slc8a3 UTSW 12 81,263,598 (GRCm39) missense possibly damaging 0.70
R7383:Slc8a3 UTSW 12 81,362,579 (GRCm39) missense probably damaging 1.00
R7392:Slc8a3 UTSW 12 81,361,577 (GRCm39) missense probably damaging 0.99
R7394:Slc8a3 UTSW 12 81,260,832 (GRCm39) splice site probably null
R7549:Slc8a3 UTSW 12 81,361,544 (GRCm39) missense probably benign 0.06
R7657:Slc8a3 UTSW 12 81,361,158 (GRCm39) missense probably damaging 1.00
R7699:Slc8a3 UTSW 12 81,361,247 (GRCm39) missense probably damaging 1.00
R7759:Slc8a3 UTSW 12 81,361,325 (GRCm39) missense probably benign
R7960:Slc8a3 UTSW 12 81,263,506 (GRCm39) missense probably benign 0.00
R7985:Slc8a3 UTSW 12 81,361,767 (GRCm39) missense probably damaging 1.00
R8059:Slc8a3 UTSW 12 81,249,032 (GRCm39) missense probably damaging 1.00
R8192:Slc8a3 UTSW 12 81,246,455 (GRCm39) missense probably damaging 1.00
R8397:Slc8a3 UTSW 12 81,246,542 (GRCm39) missense probably benign 0.45
R8413:Slc8a3 UTSW 12 81,361,452 (GRCm39) missense probably damaging 0.97
R9060:Slc8a3 UTSW 12 81,260,852 (GRCm39) missense probably benign 0.45
R9061:Slc8a3 UTSW 12 81,263,540 (GRCm39) missense probably damaging 0.99
R9267:Slc8a3 UTSW 12 81,361,208 (GRCm39) missense possibly damaging 0.77
R9416:Slc8a3 UTSW 12 81,361,838 (GRCm39) missense probably benign 0.06
R9519:Slc8a3 UTSW 12 81,362,326 (GRCm39) missense probably benign 0.30
R9531:Slc8a3 UTSW 12 81,361,997 (GRCm39) missense probably damaging 1.00
X0026:Slc8a3 UTSW 12 81,362,061 (GRCm39) missense probably benign 0.22
X0028:Slc8a3 UTSW 12 81,361,717 (GRCm39) missense probably damaging 1.00
Z1177:Slc8a3 UTSW 12 81,362,650 (GRCm39) missense probably benign 0.13
Z1177:Slc8a3 UTSW 12 81,361,474 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TATTGCCCGCACCAGTCATC -3'
(R):5'- TTGGGAAGGCCTCCTTACTC -3'

Sequencing Primer
(F):5'- ACCAGTCATCATCCGGGTG -3'
(R):5'- GGGAAGGCCTCCTTACTCTCTTC -3'
Posted On 2021-03-08