Mutagenetix > Incidental Mutation

Incidental Mutation 'R8681:Slc8a3'

661765

Institutional Source

Beutler Lab

Gene Symbol

Slc8a3

Ensembl Gene

ENSMUSG00000079055

Gene Name

solute carrier family 8 (sodium/calcium exchanger), member 3

Synonyms

Ncx3

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8681 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

81197915-81333180 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 81315140 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 302 (T302A)

Ref Sequence

ENSEMBL: ENSMUSP00000138735 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064594] [ENSMUST00000085238] [ENSMUST00000182208]

AlphaFold

S4R2P9

Predicted Effect

SMART Domains

Protein: ENSMUSP00000063258
Gene: ENSMUSG00000079055
AA Change: T302A

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	79	250	1.3e-36	PFAM
Pfam:Na_Ca_ex_C	253	379	4.6e-57	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.04e-40	SMART
low complexity region	712	723	N/A	INTRINSIC
Pfam:Na_Ca_ex	754	919	2e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000085238
AA Change: T302A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000082334
Gene: ENSMUSG00000079055
AA Change: T302A

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	79	250	1.3e-36	PFAM
Pfam:Na_Ca_ex_C	253	379	4.6e-57	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.54e-43	SMART
low complexity region	705	716	N/A	INTRINSIC
Pfam:Na_Ca_ex	747	912	1.9e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000182208
AA Change: T302A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000138735
Gene: ENSMUSG00000079055
AA Change: T302A

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	89	248	8.1e-38	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.04e-40	SMART
low complexity region	712	723	N/A	INTRINSIC
Pfam:Na_Ca_ex	764	917	9.1e-27	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium/calcium exchanger integral membrane protein family. Na+/Ca2+ exchange proteins are involved in maintaining Ca2+ homeostasis in a wide variety of cell types. The protein is regulated by intracellular calcium ions and is found in both the plasma membrane and intracellular organellar membranes, where exchange of Na+ for Ca2+ occurs in an electrogenic manner. Alternative splicing has been observed for this gene and multiple variants have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	T	C	13: 63,190,559	F583S	probably damaging	Het
A430078G23Rik	A	G	8: 3,389,074	Y477C	unknown	Het
Abcc12	A	G	8: 86,505,279	V1347A	possibly damaging	Het
Adam32	G	A	8: 24,837,795	T750I	unknown	Het
Adcy1	T	C	11: 7,161,328	I873T	probably damaging	Het
Aebp1	A	G	11: 5,867,899	D438G	probably null	Het
Anks1b	T	A	10: 90,050,006	M188K	probably damaging	Het
Ccdc114	A	G	7: 45,941,839	E246G	probably damaging	Het
Cep112	T	C	11: 108,425,652		probably null	Het
Clu	T	C	14: 65,980,957	V422A	probably damaging	Het
Cntrl	T	C	2: 35,148,588	L1050P	probably damaging	Het
Col23a1	A	T	11: 51,567,929	T298S	possibly damaging	Het
Cyp26c1	A	T	19: 37,686,617	T129S	probably damaging	Het
Cyp2c38	A	C	19: 39,401,691	V355G	possibly damaging	Het
Cyp4a30b	G	A	4: 115,457,745	V175M	possibly damaging	Het
Cyp7a1	A	T	4: 6,271,207	N316K	probably benign	Het
Dcaf17	T	A	2: 71,056,569	Y67*	probably null	Het
Dll3	T	C	7: 28,294,845	D389G	probably damaging	Het
Fbxo33	A	G	12: 59,219,044	F146L	probably benign	Het
Gm10118	C	T	10: 63,926,977	V61M	unknown	Het
Gm9611	T	C	14: 42,296,069	D102G		Het
Grik5	G	A	7: 25,010,472	A946V	probably benign	Het
Il17c	A	G	8: 122,423,468	D150G	possibly damaging	Het
Ino80e	A	G	7: 126,861,721	L22P	probably damaging	Het
Kcnh2	G	T	5: 24,331,983	T201K	probably benign	Het
Klrb1	A	C	6: 128,710,049	N173K	possibly damaging	Het
Kmt2d	T	A	15: 98,846,067	Q3737H	unknown	Het
Lemd3	T	C	10: 120,931,823	D682G	possibly damaging	Het
Lilra5	T	C	7: 4,238,217	V51A	probably benign	Het
Lrrc25	G	A	8: 70,617,664	V32I	possibly damaging	Het
Mdh1b	T	A	1: 63,715,201	M403L	probably benign	Het
Mms19	G	A	19: 41,949,476	L765F	probably damaging	Het
Msx3	T	A	7: 140,048,987	T5S	probably benign	Het
Myh13	A	C	11: 67,352,134	I958L	possibly damaging	Het
Myo18b	T	A	5: 112,873,563		probably null	Het
Myo9a	G	A	9: 59,868,111	V1002I	probably benign	Het
Neb	T	C	2: 52,237,036	K379R	probably damaging	Het
Nsmce2	A	G	15: 59,601,359	S216G	probably benign	Het
Olfr1109	A	T	2: 87,093,046	M117K	possibly damaging	Het
Olfr746	A	T	14: 50,653,344	M36L	probably benign	Het
Pkp2	A	T	16: 16,230,681	M317L	probably benign	Het
Pogz	T	A	3: 94,860,923	H137Q	probably damaging	Het
Prrx2	G	T	2: 30,845,507	D25Y	unknown	Het
Ptprf	T	C	4: 118,231,647	D653G	probably benign	Het
Rps6kl1	T	A	12: 85,147,855	E94V	probably damaging	Het
Slc44a1	A	T	4: 53,481,510	D27V	probably damaging	Het
Slc44a4	A	G	17: 34,928,277	I549V	possibly damaging	Het
Spic	T	A	10: 88,675,985	K136N	possibly damaging	Het
Stk36	T	C	1: 74,622,233	L473P	probably damaging	Het
Syce1	G	A	7: 140,782,074	T32I	possibly damaging	Het
Tars2	G	A	3: 95,750,887	Q209*	probably null	Het
Tmem9b	A	G	7: 109,745,320	V100A	probably benign	Het
Vmn1r67	A	G	7: 10,447,201	I131V	probably benign	Het
Vmn2r26	C	T	6: 124,024,918	T54I	probably benign	Het
Zfp142	T	C	1: 74,571,588	E1016G	probably damaging	Het
Zfp773	T	C	7: 7,136,483	T56A	possibly damaging	Het

Other mutations in Slc8a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:Slc8a3	APN	12	81314569	missense	probably benign
IGL01315:Slc8a3	APN	12	81314395	missense	probably damaging	0.97
IGL01365:Slc8a3	APN	12	81315376	missense	probably damaging	0.99
IGL01610:Slc8a3	APN	12	81315802	missense	probably damaging	1.00
IGL02227:Slc8a3	APN	12	81315683	missense	probably damaging	1.00
IGL02299:Slc8a3	APN	12	81315224	missense	probably damaging	0.98
IGL02548:Slc8a3	APN	12	81204156	splice site	probably benign
IGL02646:Slc8a3	APN	12	81315094	missense	probably damaging	1.00
IGL03135:Slc8a3	APN	12	81202249	missense	probably damaging	1.00
R0050:Slc8a3	UTSW	12	81315265	missense	probably damaging	1.00
R0627:Slc8a3	UTSW	12	81314842	missense	probably damaging	1.00
R0648:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R1342:Slc8a3	UTSW	12	81316016	missense	probably damaging	0.99
R1437:Slc8a3	UTSW	12	81315986	missense	probably damaging	0.99
R1470:Slc8a3	UTSW	12	81199710	missense	probably benign
R1470:Slc8a3	UTSW	12	81199710	missense	probably benign
R1557:Slc8a3	UTSW	12	81315557	missense	probably damaging	1.00
R1563:Slc8a3	UTSW	12	81205007	missense	possibly damaging	0.47
R1918:Slc8a3	UTSW	12	81314844	missense	probably damaging	0.99
R1930:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R1931:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R2232:Slc8a3	UTSW	12	81315220	missense	probably damaging	0.99
R2680:Slc8a3	UTSW	12	81202339	missense	probably damaging	0.99
R2941:Slc8a3	UTSW	12	81315179	missense	probably damaging	1.00
R3157:Slc8a3	UTSW	12	81314992	missense	probably damaging	1.00
R3159:Slc8a3	UTSW	12	81314992	missense	probably damaging	1.00
R3751:Slc8a3	UTSW	12	81204138	missense	probably damaging	1.00
R3859:Slc8a3	UTSW	12	81314872	missense	probably damaging	0.99
R4240:Slc8a3	UTSW	12	81315176	missense	probably damaging	0.99
R4527:Slc8a3	UTSW	12	81315853	missense	probably damaging	1.00
R4547:Slc8a3	UTSW	12	81314851	missense	possibly damaging	0.76
R4951:Slc8a3	UTSW	12	81314699	missense	probably benign	0.31
R4951:Slc8a3	UTSW	12	81315986	missense	probably damaging	0.99
R5022:Slc8a3	UTSW	12	81199558	missense	probably damaging	0.96
R5049:Slc8a3	UTSW	12	81214132	missense	probably damaging	1.00
R5057:Slc8a3	UTSW	12	81199558	missense	probably damaging	0.96
R5104:Slc8a3	UTSW	12	81214134	missense	probably null	0.34
R5122:Slc8a3	UTSW	12	81314258	critical splice donor site	probably null
R5183:Slc8a3	UTSW	12	81314491	missense	possibly damaging	0.79
R5629:Slc8a3	UTSW	12	81199631	missense	probably damaging	1.00
R6062:Slc8a3	UTSW	12	81314350	missense	probably damaging	1.00
R6218:Slc8a3	UTSW	12	81199567	missense	probably benign
R6279:Slc8a3	UTSW	12	81314978	missense	probably damaging	0.99
R6300:Slc8a3	UTSW	12	81314978	missense	probably damaging	0.99
R6416:Slc8a3	UTSW	12	81315627	missense	probably damaging	1.00
R6790:Slc8a3	UTSW	12	81314432	missense	probably benign	0.00
R6999:Slc8a3	UTSW	12	81314755	missense	probably benign	0.06
R7195:Slc8a3	UTSW	12	81314273	missense	possibly damaging	0.95
R7268:Slc8a3	UTSW	12	81315053	missense	probably damaging	0.98
R7288:Slc8a3	UTSW	12	81216824	missense	possibly damaging	0.70
R7383:Slc8a3	UTSW	12	81315805	missense	probably damaging	1.00
R7392:Slc8a3	UTSW	12	81314803	missense	probably damaging	0.99
R7394:Slc8a3	UTSW	12	81214058	splice site	probably null
R7549:Slc8a3	UTSW	12	81314770	missense	probably benign	0.06
R7657:Slc8a3	UTSW	12	81314384	missense	probably damaging	1.00
R7699:Slc8a3	UTSW	12	81314473	missense	probably damaging	1.00
R7759:Slc8a3	UTSW	12	81314551	missense	probably benign
R7960:Slc8a3	UTSW	12	81216732	missense	probably benign	0.00
R7985:Slc8a3	UTSW	12	81314993	missense	probably damaging	1.00
R8059:Slc8a3	UTSW	12	81202258	missense	probably damaging	1.00
R8192:Slc8a3	UTSW	12	81199681	missense	probably damaging	1.00
R8397:Slc8a3	UTSW	12	81199768	missense	probably benign	0.45
R8413:Slc8a3	UTSW	12	81314678	missense	probably damaging	0.97
R9060:Slc8a3	UTSW	12	81214078	missense	probably benign	0.45
R9061:Slc8a3	UTSW	12	81216766	missense	probably damaging	0.99
R9267:Slc8a3	UTSW	12	81314434	missense	possibly damaging	0.77
R9416:Slc8a3	UTSW	12	81315064	missense	probably benign	0.06
R9519:Slc8a3	UTSW	12	81315552	missense	probably benign	0.30
R9531:Slc8a3	UTSW	12	81315223	missense	probably damaging	1.00
X0026:Slc8a3	UTSW	12	81315287	missense	probably benign	0.22
X0028:Slc8a3	UTSW	12	81314943	missense	probably damaging	1.00
Z1177:Slc8a3	UTSW	12	81314700	missense	possibly damaging	0.92
Z1177:Slc8a3	UTSW	12	81315876	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- TATTGCCCGCACCAGTCATC -3'
(R):5'- TTGGGAAGGCCTCCTTACTC -3'

Sequencing Primer
(F):5'- ACCAGTCATCATCCGGGTG -3'
(R):5'- GGGAAGGCCTCCTTACTCTCTTC -3'

Posted On

2021-03-08