Incidental Mutation 'R8681:Cyp2c38'
ID 661776
Institutional Source Beutler Lab
Gene Symbol Cyp2c38
Ensembl Gene ENSMUSG00000032808
Gene Name cytochrome P450, family 2, subfamily c, polypeptide 38
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock # R8681 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 39389556-39463075 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 39401691 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 355 (V355G)
Ref Sequence ENSEMBL: ENSMUSP00000044722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035488]
AlphaFold P56655
Predicted Effect possibly damaging
Transcript: ENSMUST00000035488
AA Change: V355G

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000044722
Gene: ENSMUSG00000032808
AA Change: V355G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:p450 30 487 1.5e-161 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,190,559 F583S probably damaging Het
A430078G23Rik A G 8: 3,389,074 Y477C unknown Het
Abcc12 A G 8: 86,505,279 V1347A possibly damaging Het
Adam32 G A 8: 24,837,795 T750I unknown Het
Adcy1 T C 11: 7,161,328 I873T probably damaging Het
Aebp1 A G 11: 5,867,899 D438G probably null Het
Anks1b T A 10: 90,050,006 M188K probably damaging Het
Ccdc114 A G 7: 45,941,839 E246G probably damaging Het
Cep112 T C 11: 108,425,652 probably null Het
Clu T C 14: 65,980,957 V422A probably damaging Het
Cntrl T C 2: 35,148,588 L1050P probably damaging Het
Col23a1 A T 11: 51,567,929 T298S possibly damaging Het
Cyp26c1 A T 19: 37,686,617 T129S probably damaging Het
Cyp4a30b G A 4: 115,457,745 V175M possibly damaging Het
Cyp7a1 A T 4: 6,271,207 N316K probably benign Het
Dcaf17 T A 2: 71,056,569 Y67* probably null Het
Dll3 T C 7: 28,294,845 D389G probably damaging Het
Fbxo33 A G 12: 59,219,044 F146L probably benign Het
Gm10118 C T 10: 63,926,977 V61M unknown Het
Gm9611 T C 14: 42,296,069 D102G Het
Grik5 G A 7: 25,010,472 A946V probably benign Het
Il17c A G 8: 122,423,468 D150G possibly damaging Het
Ino80e A G 7: 126,861,721 L22P probably damaging Het
Kcnh2 G T 5: 24,331,983 T201K probably benign Het
Klrb1 A C 6: 128,710,049 N173K possibly damaging Het
Kmt2d T A 15: 98,846,067 Q3737H unknown Het
Lemd3 T C 10: 120,931,823 D682G possibly damaging Het
Lilra5 T C 7: 4,238,217 V51A probably benign Het
Lrrc25 G A 8: 70,617,664 V32I possibly damaging Het
Mdh1b T A 1: 63,715,201 M403L probably benign Het
Mms19 G A 19: 41,949,476 L765F probably damaging Het
Msx3 T A 7: 140,048,987 T5S probably benign Het
Myh13 A C 11: 67,352,134 I958L possibly damaging Het
Myo18b T A 5: 112,873,563 probably null Het
Myo9a G A 9: 59,868,111 V1002I probably benign Het
Neb T C 2: 52,237,036 K379R probably damaging Het
Nsmce2 A G 15: 59,601,359 S216G probably benign Het
Olfr1109 A T 2: 87,093,046 M117K possibly damaging Het
Olfr746 A T 14: 50,653,344 M36L probably benign Het
Pkp2 A T 16: 16,230,681 M317L probably benign Het
Pogz T A 3: 94,860,923 H137Q probably damaging Het
Prrx2 G T 2: 30,845,507 D25Y unknown Het
Ptprf T C 4: 118,231,647 D653G probably benign Het
Rps6kl1 T A 12: 85,147,855 E94V probably damaging Het
Slc44a1 A T 4: 53,481,510 D27V probably damaging Het
Slc44a4 A G 17: 34,928,277 I549V possibly damaging Het
Slc8a3 T C 12: 81,315,140 T302A probably benign Het
Spic T A 10: 88,675,985 K136N possibly damaging Het
Stk36 T C 1: 74,622,233 L473P probably damaging Het
Syce1 G A 7: 140,782,074 T32I possibly damaging Het
Tars2 G A 3: 95,750,887 Q209* probably null Het
Tmem9b A G 7: 109,745,320 V100A probably benign Het
Vmn1r67 A G 7: 10,447,201 I131V probably benign Het
Vmn2r26 C T 6: 124,024,918 T54I probably benign Het
Zfp142 T C 1: 74,571,588 E1016G probably damaging Het
Zfp773 T C 7: 7,136,483 T56A possibly damaging Het
Other mutations in Cyp2c38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Cyp2c38 APN 19 39460725 nonsense probably null
IGL01109:Cyp2c38 APN 19 39462885 critical splice donor site probably null
IGL01521:Cyp2c38 APN 19 39460670 missense probably damaging 0.99
IGL02036:Cyp2c38 APN 19 39460316 missense probably null 0.97
IGL02187:Cyp2c38 APN 19 39436205 missense probably benign 0.14
IGL02954:Cyp2c38 APN 19 39391076 missense probably damaging 0.99
R0479:Cyp2c38 UTSW 19 39463005 missense probably damaging 0.99
R0684:Cyp2c38 UTSW 19 39391056 missense probably damaging 0.99
R0919:Cyp2c38 UTSW 19 39404669 missense probably benign 0.07
R1462:Cyp2c38 UTSW 19 39392188 missense probably damaging 0.96
R1462:Cyp2c38 UTSW 19 39392188 missense probably damaging 0.96
R1642:Cyp2c38 UTSW 19 39401709 missense probably damaging 1.00
R1715:Cyp2c38 UTSW 19 39404795 missense probably benign 0.25
R1900:Cyp2c38 UTSW 19 39438312 missense probably benign 0.40
R1954:Cyp2c38 UTSW 19 39404687 missense probably damaging 0.99
R1955:Cyp2c38 UTSW 19 39404687 missense probably damaging 0.99
R2860:Cyp2c38 UTSW 19 39460694 missense probably benign 0.01
R2861:Cyp2c38 UTSW 19 39460694 missense probably benign 0.01
R2862:Cyp2c38 UTSW 19 39460694 missense probably benign 0.01
R3084:Cyp2c38 UTSW 19 39401701 missense probably benign 0.00
R3727:Cyp2c38 UTSW 19 39392295 splice site probably benign
R4648:Cyp2c38 UTSW 19 39460688 missense probably benign 0.05
R5119:Cyp2c38 UTSW 19 39460621 missense probably damaging 1.00
R5636:Cyp2c38 UTSW 19 39438306 nonsense probably null
R5651:Cyp2c38 UTSW 19 39460712 missense probably damaging 0.99
R6263:Cyp2c38 UTSW 19 39392215 missense probably damaging 1.00
R6384:Cyp2c38 UTSW 19 39392293 splice site probably null
R6853:Cyp2c38 UTSW 19 39438304 missense probably benign 0.02
R6915:Cyp2c38 UTSW 19 39436068 missense probably damaging 0.99
R7201:Cyp2c38 UTSW 19 39401776 missense probably damaging 1.00
R7570:Cyp2c38 UTSW 19 39404743 missense possibly damaging 0.76
R7625:Cyp2c38 UTSW 19 39462924 missense possibly damaging 0.78
R7666:Cyp2c38 UTSW 19 39438242 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- GTAGATCTGCCCTCTGAACC -3'
(R):5'- ATTGCGTTGTGTATAGCCTGAC -3'

Sequencing Primer
(F):5'- GTAGATCTGCCCTCTGAACCATAAAG -3'
(R):5'- CGTTGTGTATAGCCTGACATTGTAAC -3'
Posted On 2021-03-08