Incidental Mutation 'R8682:Pfkfb3'
ID 661782
Institutional Source Beutler Lab
Gene Symbol Pfkfb3
Ensembl Gene ENSMUSG00000026773
Gene Name 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3
Synonyms E330010H22Rik, uPFK-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8682 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 11471433-11554077 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 11484333 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 264 (K264E)
Ref Sequence ENSEMBL: ENSMUSP00000142296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028114] [ENSMUST00000049849] [ENSMUST00000100411] [ENSMUST00000114844] [ENSMUST00000114845] [ENSMUST00000114846] [ENSMUST00000170196] [ENSMUST00000171188] [ENSMUST00000179584] [ENSMUST00000183869] [ENSMUST00000191668] [ENSMUST00000192949] [ENSMUST00000195779]
AlphaFold A7UAK5
Predicted Effect probably benign
Transcript: ENSMUST00000028114
AA Change: K284E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000028114
Gene: ENSMUSG00000026773
AA Change: K284E

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 2.6e-110 PFAM
Pfam:KTI12 36 218 7e-9 PFAM
Pfam:AAA_33 37 191 1.7e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000049849
AA Change: K284E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000050926
Gene: ENSMUSG00000026773
AA Change: K284E

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 3.3e-110 PFAM
Pfam:KTI12 36 218 9.7e-9 PFAM
Pfam:AAA_33 37 191 1.9e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100411
AA Change: K284E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097979
Gene: ENSMUSG00000026773
AA Change: K284E

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 5.8e-110 PFAM
Pfam:KTI12 36 219 9.6e-9 PFAM
Pfam:AAA_33 37 191 2.4e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114844
AA Change: K284E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000110493
Gene: ENSMUSG00000026773
AA Change: K284E

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 6.6e-110 PFAM
Pfam:KTI12 36 218 1.1e-8 PFAM
Pfam:AAA_33 37 191 2.6e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114845
AA Change: K284E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110494
Gene: ENSMUSG00000026773
AA Change: K284E

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 2.6e-110 PFAM
Pfam:KTI12 36 218 7e-9 PFAM
Pfam:AAA_33 37 191 1.7e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114846
AA Change: K284E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110495
Gene: ENSMUSG00000026773
AA Change: K284E

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 3.1e-110 PFAM
Pfam:KTI12 36 219 9e-9 PFAM
Pfam:AAA_33 37 191 1.9e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170196
AA Change: K284E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000126305
Gene: ENSMUSG00000026773
AA Change: K284E

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 3.4e-110 PFAM
Pfam:KTI12 36 218 9.9e-9 PFAM
Pfam:AAA_33 37 191 2e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171188
AA Change: K284E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000129122
Gene: ENSMUSG00000026773
AA Change: K284E

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 3.2e-110 PFAM
Pfam:KTI12 36 209 4.2e-8 PFAM
Pfam:AAA_33 37 167 1.8e-9 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179584
AA Change: K284E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000137130
Gene: ENSMUSG00000026773
AA Change: K284E

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 2.3e-110 PFAM
Pfam:KTI12 36 225 7e-9 PFAM
Pfam:AAA_33 37 191 1.5e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183869
AA Change: K284E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138893
Gene: ENSMUSG00000026773
AA Change: K284E

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 2.3e-110 PFAM
Pfam:KTI12 36 225 7e-9 PFAM
Pfam:AAA_33 37 191 1.5e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191668
AA Change: K284E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000142079
Gene: ENSMUSG00000026773
AA Change: K284E

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 3.6e-110 PFAM
Pfam:KTI12 36 218 1e-8 PFAM
Pfam:AAA_33 37 191 2.1e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192949
AA Change: K264E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142296
Gene: ENSMUSG00000026773
AA Change: K264E

DomainStartEndE-ValueType
Pfam:6PF2K 3 226 1.9e-107 PFAM
Pfam:KTI12 16 200 3.9e-6 PFAM
Pfam:AAA_33 17 171 1.9e-8 PFAM
PGAM 228 375 3.8e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195779
AA Change: K280E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000141445
Gene: ENSMUSG00000026773
AA Change: K280E

DomainStartEndE-ValueType
Pfam:6PF2K 3 159 1.3e-69 PFAM
Pfam:KTI12 16 212 1.8e-6 PFAM
Pfam:AAA_33 17 163 1.6e-9 PFAM
Pfam:6PF2K 158 242 2.2e-32 PFAM
Pfam:His_Phos_1 244 326 3.4e-13 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of bifunctional proteins that are involved in both the synthesis and degradation of fructose-2,6-bisphosphate, a regulatory molecule that controls glycolysis in eukaryotes. The encoded protein has a 6-phosphofructo-2-kinase activity that catalyzes the synthesis of fructose-2,6-bisphosphate (F2,6BP), and a fructose-2,6-biphosphatase activity that catalyzes the degradation of F2,6BP. This protein is required for cell cycle progression and prevention of apoptosis. It functions as a regulator of cyclin-dependent kinase 1, linking glucose metabolism to cell proliferation and survival in tumor cells. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous null mice display embryonic lethality before E8 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T A 11: 58,423,899 L141Q probably null Het
Abtb2 A T 2: 103,567,375 T217S probably benign Het
Adcy1 T C 11: 7,161,328 I873T probably damaging Het
Angpt4 A G 2: 151,927,085 M172V probably benign Het
Apaf1 A T 10: 90,995,670 V1194D probably damaging Het
Arhgap30 T C 1: 171,407,402 S479P probably benign Het
Asah2 C T 19: 32,052,877 V132M probably damaging Het
Bmp10 A G 6: 87,433,559 probably null Het
Bsn T C 9: 108,106,169 Y790C Het
Cacna2d1 C A 5: 16,353,839 R732S possibly damaging Het
Casr A T 16: 36,495,422 F762Y possibly damaging Het
Cbln1 T C 8: 87,472,107 D45G possibly damaging Het
Cd177 A T 7: 24,760,013 M61K possibly damaging Het
Cdh11 T C 8: 102,650,716 I433V probably benign Het
Cdhr5 A G 7: 141,275,986 probably null Het
Col12a1 T A 9: 79,661,076 K1622I probably benign Het
Cyp2d9 A G 15: 82,453,716 D103G probably damaging Het
Fem1b A T 9: 62,797,150 L276* probably null Het
Fggy T A 4: 95,812,121 V343E probably damaging Het
Flt3 A G 5: 147,383,455 V33A probably benign Het
Gm6904 G A 14: 59,258,584 T27I probably benign Het
Gm8994 A G 6: 136,329,029 T163A possibly damaging Het
Grn T C 11: 102,434,820 Y288H probably benign Het
Grtp1 G A 8: 13,179,499 R272W probably damaging Het
H2-Aa A G 17: 34,283,760 I144T possibly damaging Het
Herc1 A G 9: 66,462,848 D469G Het
Hsf2 G A 10: 57,505,171 E286K possibly damaging Het
Hydin A G 8: 110,309,166 E163G probably damaging Het
Il6ra A G 3: 89,886,669 I224T possibly damaging Het
Itih3 T A 14: 30,920,716 I204F possibly damaging Het
Kcnj9 A T 1: 172,326,113 M148K possibly damaging Het
Lepr T G 4: 101,792,072 V890G probably benign Het
Mslnl A G 17: 25,746,988 D612G probably benign Het
Myl2 T A 5: 122,106,735 V156D probably damaging Het
Neb C A 2: 52,246,845 W3208L probably damaging Het
Neto2 T C 8: 85,640,666 Y511C probably benign Het
Obox2 C A 7: 15,396,987 T48K possibly damaging Het
Olfr1109 A T 2: 87,093,046 M117K possibly damaging Het
Olfr305 C T 7: 86,364,165 M57I probably damaging Het
Olfr568 T A 7: 102,877,439 F106L probably benign Het
Osbpl6 C G 2: 76,577,081 H486D probably benign Het
Pla2r1 T A 2: 60,422,776 T1324S possibly damaging Het
Plekhg1 A T 10: 3,947,523 Y495F Het
Ppp2r5d T C 17: 46,687,063 K225E probably benign Het
Ptpn11 T C 5: 121,167,990 D64G possibly damaging Het
Ptprs A G 17: 56,435,849 I431T probably damaging Het
Rapgef5 T C 12: 117,581,812 S100P probably benign Het
Rnf219 G T 14: 104,480,233 R235S probably damaging Het
Shh T A 5: 28,458,060 H370L probably benign Het
Siah3 A T 14: 75,525,603 H98L possibly damaging Het
Sim2 C T 16: 94,123,333 H446Y probably benign Het
Skint4 T C 4: 112,136,040 I320T possibly damaging Het
Sorcs1 A T 19: 50,378,960 N221K probably damaging Het
Sox6 T C 7: 115,476,956 S816G probably damaging Het
Sphkap T C 1: 83,279,276 T251A probably benign Het
Stard9 T C 2: 120,703,315 V3351A possibly damaging Het
Tbc1d15 A G 10: 115,210,290 V436A probably benign Het
Thsd7b A T 1: 129,760,274 K641* probably null Het
Tmc5 G T 7: 118,670,702 V892F possibly damaging Het
Tpsab1 T A 17: 25,343,711 H238L probably benign Het
Trank1 A G 9: 111,365,344 N812S probably benign Het
Trio T A 15: 27,905,192 N163Y unknown Het
Ttc39d A G 17: 80,217,264 T451A probably benign Het
Ube3b T C 5: 114,412,290 L832P probably damaging Het
Vmn2r15 C A 5: 109,294,072 C165F probably damaging Het
Vmn2r90 T C 17: 17,712,082 F84L possibly damaging Het
Wdr60 A T 12: 116,224,990 H661Q probably damaging Het
Wdr95 C T 5: 149,595,287 T531I possibly damaging Het
Zcrb1 C A 15: 93,386,237 G191V probably benign Het
Zfp111 G A 7: 24,198,558 P544S probably damaging Het
Zfyve9 T C 4: 108,719,342 S181G probably benign Het
Other mutations in Pfkfb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00767:Pfkfb3 APN 2 11488754 missense probably damaging 1.00
IGL01651:Pfkfb3 APN 2 11489684 missense probably damaging 0.97
IGL02010:Pfkfb3 APN 2 11483994 missense probably benign
IGL02546:Pfkfb3 APN 2 11488778 missense probably damaging 1.00
IGL03182:Pfkfb3 APN 2 11501663 missense probably damaging 0.99
R1491:Pfkfb3 UTSW 2 11493936 missense probably damaging 1.00
R2365:Pfkfb3 UTSW 2 11493902 critical splice donor site probably null
R2919:Pfkfb3 UTSW 2 11484327 missense probably benign 0.00
R2920:Pfkfb3 UTSW 2 11484327 missense probably benign 0.00
R4709:Pfkfb3 UTSW 2 11493908 missense probably damaging 1.00
R4863:Pfkfb3 UTSW 2 11486312 missense probably benign
R4915:Pfkfb3 UTSW 2 11490298 nonsense probably null
R5087:Pfkfb3 UTSW 2 11484014 missense probably damaging 1.00
R5109:Pfkfb3 UTSW 2 11486351 splice site probably benign
R5244:Pfkfb3 UTSW 2 11484849 missense probably damaging 1.00
R5488:Pfkfb3 UTSW 2 11484669 missense probably benign 0.00
R5573:Pfkfb3 UTSW 2 11501672 missense probably benign 0.28
R5619:Pfkfb3 UTSW 2 11484659 missense probably benign 0.00
R5757:Pfkfb3 UTSW 2 11480330 missense probably damaging 0.99
R6015:Pfkfb3 UTSW 2 11481335 critical splice acceptor site probably null
R7495:Pfkfb3 UTSW 2 11482501 missense probably damaging 1.00
R7688:Pfkfb3 UTSW 2 11492639 missense probably damaging 1.00
R7813:Pfkfb3 UTSW 2 11481908 missense probably benign 0.12
R8911:Pfkfb3 UTSW 2 11482443 critical splice donor site probably null
R9103:Pfkfb3 UTSW 2 11482570 missense probably damaging 1.00
R9198:Pfkfb3 UTSW 2 11486273 missense probably damaging 1.00
R9423:Pfkfb3 UTSW 2 11482465 missense probably damaging 1.00
R9632:Pfkfb3 UTSW 2 11481298 missense probably benign
R9682:Pfkfb3 UTSW 2 11486247 missense probably benign 0.26
X0024:Pfkfb3 UTSW 2 11482555 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAACTCTCCATTCCCTGCCA -3'
(R):5'- CCTCCTTGTTGTAGAGTTGAGGG -3'

Sequencing Primer
(F):5'- AGGCCTCCCCTCAGCAG -3'
(R):5'- TGCCTTACTATGTTGTATGTATTTGC -3'
Posted On 2021-03-08