Incidental Mutation 'R8682:Abtb2'
ID 661787
Institutional Source Beutler Lab
Gene Symbol Abtb2
Ensembl Gene ENSMUSG00000032724
Gene Name ankyrin repeat and BTB (POZ) domain containing 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8682 (G1)
Quality Score 199.009
Status Not validated
Chromosome 2
Chromosomal Location 103566310-103718423 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 103567375 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 217 (T217S)
Ref Sequence ENSEMBL: ENSMUSP00000075566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076212]
AlphaFold Q7TQI7
Predicted Effect probably benign
Transcript: ENSMUST00000076212
AA Change: T217S

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000075566
Gene: ENSMUSG00000032724
AA Change: T217S

DomainStartEndE-ValueType
low complexity region 29 48 N/A INTRINSIC
low complexity region 122 143 N/A INTRINSIC
Blast:H2A 186 301 2e-38 BLAST
low complexity region 366 376 N/A INTRINSIC
ANK 521 550 4.78e-7 SMART
ANK 567 596 6.26e-2 SMART
ANK 606 635 3.65e-3 SMART
ANK 649 678 5.52e2 SMART
ANK 715 746 1.84e3 SMART
BTB 844 946 9.15e-24 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T A 11: 58,423,899 L141Q probably null Het
Adcy1 T C 11: 7,161,328 I873T probably damaging Het
Angpt4 A G 2: 151,927,085 M172V probably benign Het
Apaf1 A T 10: 90,995,670 V1194D probably damaging Het
Arhgap30 T C 1: 171,407,402 S479P probably benign Het
Asah2 C T 19: 32,052,877 V132M probably damaging Het
Bmp10 A G 6: 87,433,559 probably null Het
Bsn T C 9: 108,106,169 Y790C Het
Cacna2d1 C A 5: 16,353,839 R732S possibly damaging Het
Casr A T 16: 36,495,422 F762Y possibly damaging Het
Cbln1 T C 8: 87,472,107 D45G possibly damaging Het
Cd177 A T 7: 24,760,013 M61K possibly damaging Het
Cdh11 T C 8: 102,650,716 I433V probably benign Het
Cdhr5 A G 7: 141,275,986 probably null Het
Col12a1 T A 9: 79,661,076 K1622I probably benign Het
Cyp2d9 A G 15: 82,453,716 D103G probably damaging Het
Fem1b A T 9: 62,797,150 L276* probably null Het
Fggy T A 4: 95,812,121 V343E probably damaging Het
Flt3 A G 5: 147,383,455 V33A probably benign Het
Gm6904 G A 14: 59,258,584 T27I probably benign Het
Gm8994 A G 6: 136,329,029 T163A possibly damaging Het
Grn T C 11: 102,434,820 Y288H probably benign Het
Grtp1 G A 8: 13,179,499 R272W probably damaging Het
H2-Aa A G 17: 34,283,760 I144T possibly damaging Het
Herc1 A G 9: 66,462,848 D469G Het
Hsf2 G A 10: 57,505,171 E286K possibly damaging Het
Hydin A G 8: 110,309,166 E163G probably damaging Het
Il6ra A G 3: 89,886,669 I224T possibly damaging Het
Itih3 T A 14: 30,920,716 I204F possibly damaging Het
Kcnj9 A T 1: 172,326,113 M148K possibly damaging Het
Lepr T G 4: 101,792,072 V890G probably benign Het
Mslnl A G 17: 25,746,988 D612G probably benign Het
Myl2 T A 5: 122,106,735 V156D probably damaging Het
Neb C A 2: 52,246,845 W3208L probably damaging Het
Neto2 T C 8: 85,640,666 Y511C probably benign Het
Obox2 C A 7: 15,396,987 T48K possibly damaging Het
Olfr1109 A T 2: 87,093,046 M117K possibly damaging Het
Olfr305 C T 7: 86,364,165 M57I probably damaging Het
Olfr568 T A 7: 102,877,439 F106L probably benign Het
Osbpl6 C G 2: 76,577,081 H486D probably benign Het
Pfkfb3 T C 2: 11,484,333 K264E probably benign Het
Pla2r1 T A 2: 60,422,776 T1324S possibly damaging Het
Plekhg1 A T 10: 3,947,523 Y495F Het
Ppp2r5d T C 17: 46,687,063 K225E probably benign Het
Ptpn11 T C 5: 121,167,990 D64G possibly damaging Het
Ptprs A G 17: 56,435,849 I431T probably damaging Het
Rapgef5 T C 12: 117,581,812 S100P probably benign Het
Rnf219 G T 14: 104,480,233 R235S probably damaging Het
Shh T A 5: 28,458,060 H370L probably benign Het
Siah3 A T 14: 75,525,603 H98L possibly damaging Het
Sim2 C T 16: 94,123,333 H446Y probably benign Het
Skint4 T C 4: 112,136,040 I320T possibly damaging Het
Sorcs1 A T 19: 50,378,960 N221K probably damaging Het
Sox6 T C 7: 115,476,956 S816G probably damaging Het
Sphkap T C 1: 83,279,276 T251A probably benign Het
Stard9 T C 2: 120,703,315 V3351A possibly damaging Het
Tbc1d15 A G 10: 115,210,290 V436A probably benign Het
Thsd7b A T 1: 129,760,274 K641* probably null Het
Tmc5 G T 7: 118,670,702 V892F possibly damaging Het
Tpsab1 T A 17: 25,343,711 H238L probably benign Het
Trank1 A G 9: 111,365,344 N812S probably benign Het
Trio T A 15: 27,905,192 N163Y unknown Het
Ttc39d A G 17: 80,217,264 T451A probably benign Het
Ube3b T C 5: 114,412,290 L832P probably damaging Het
Vmn2r15 C A 5: 109,294,072 C165F probably damaging Het
Vmn2r90 T C 17: 17,712,082 F84L possibly damaging Het
Wdr60 A T 12: 116,224,990 H661Q probably damaging Het
Wdr95 C T 5: 149,595,287 T531I possibly damaging Het
Zcrb1 C A 15: 93,386,237 G191V probably benign Het
Zfp111 G A 7: 24,198,558 P544S probably damaging Het
Zfyve9 T C 4: 108,719,342 S181G probably benign Het
Other mutations in Abtb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Abtb2 APN 2 103705118 missense probably benign 0.00
IGL02605:Abtb2 APN 2 103717257 missense probably benign
IGL03161:Abtb2 APN 2 103567454 missense probably benign 0.02
PIT4504001:Abtb2 UTSW 2 103717192 nonsense probably null
R0147:Abtb2 UTSW 2 103567135 missense probably benign 0.04
R1052:Abtb2 UTSW 2 103705072 missense possibly damaging 0.46
R1419:Abtb2 UTSW 2 103709420 missense probably benign 0.00
R1518:Abtb2 UTSW 2 103709284 missense probably benign 0.03
R1650:Abtb2 UTSW 2 103702402 missense probably damaging 1.00
R1795:Abtb2 UTSW 2 103567024 missense probably benign 0.00
R2054:Abtb2 UTSW 2 103705117 missense probably benign 0.41
R2101:Abtb2 UTSW 2 103566862 missense probably benign 0.05
R2363:Abtb2 UTSW 2 103567183 missense probably damaging 1.00
R3440:Abtb2 UTSW 2 103567232 missense probably benign 0.43
R3927:Abtb2 UTSW 2 103708218 splice site probably null
R4351:Abtb2 UTSW 2 103683393 missense possibly damaging 0.46
R4352:Abtb2 UTSW 2 103683393 missense possibly damaging 0.46
R4782:Abtb2 UTSW 2 103717299 missense probably benign 0.35
R4814:Abtb2 UTSW 2 103717287 missense probably benign 0.08
R4831:Abtb2 UTSW 2 103683475 missense probably benign 0.06
R4900:Abtb2 UTSW 2 103567004 missense possibly damaging 0.62
R5038:Abtb2 UTSW 2 103567063 missense probably damaging 0.99
R5513:Abtb2 UTSW 2 103709278 critical splice acceptor site probably null
R6119:Abtb2 UTSW 2 103702310 missense probably benign 0.00
R6298:Abtb2 UTSW 2 103709488 missense probably benign 0.10
R6383:Abtb2 UTSW 2 103567376 missense probably damaging 0.98
R6860:Abtb2 UTSW 2 103709425 nonsense probably null
R7000:Abtb2 UTSW 2 103712442 missense possibly damaging 0.85
R7109:Abtb2 UTSW 2 103715515 missense probably benign 0.20
R7176:Abtb2 UTSW 2 103709375 missense probably benign 0.00
R7189:Abtb2 UTSW 2 103567516 missense probably benign 0.00
R7199:Abtb2 UTSW 2 103567220 missense possibly damaging 0.74
R7299:Abtb2 UTSW 2 103702424 splice site probably null
R7347:Abtb2 UTSW 2 103567412 missense probably damaging 1.00
R7469:Abtb2 UTSW 2 103566947 missense probably benign 0.00
R7629:Abtb2 UTSW 2 103683493 critical splice donor site probably null
R7862:Abtb2 UTSW 2 103702281 missense probably damaging 1.00
R8200:Abtb2 UTSW 2 103700817 missense probably benign 0.02
R8700:Abtb2 UTSW 2 103566944 missense probably damaging 0.99
R9164:Abtb2 UTSW 2 103711484 missense possibly damaging 0.50
R9196:Abtb2 UTSW 2 103683302 missense possibly damaging 0.71
R9254:Abtb2 UTSW 2 103711235 missense probably benign 0.00
R9258:Abtb2 UTSW 2 103716065 missense probably null 0.99
R9343:Abtb2 UTSW 2 103717160 missense probably benign
R9427:Abtb2 UTSW 2 103700899 missense probably damaging 1.00
R9675:Abtb2 UTSW 2 103708187 missense probably benign
Z1176:Abtb2 UTSW 2 103708172 nonsense probably null
Z1177:Abtb2 UTSW 2 103711196 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTCCGGCTCCATGAACAG -3'
(R):5'- CGTCGTTGTTGATGACCATCTC -3'

Sequencing Primer
(F):5'- TAAGTGCACCCGCTTCGAG -3'
(R):5'- GTTGATGACCATCTCCAAGGC -3'
Posted On 2021-03-08