Mutagenetix > Incidental Mutation

Incidental Mutation 'R8682:Ube3b'

661798

Institutional Source

Beutler Lab

Gene Symbol

Ube3b

Ensembl Gene

ENSMUSG00000029577

Gene Name

ubiquitin protein ligase E3B

Synonyms

MMRRC Submission

068537-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8682 (G1)

Quality Score

194.009

Status

Not validated

Chromosome

Chromosomal Location

114380607-114421169 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 114412290 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 832 (L832P)

Ref Sequence

ENSEMBL: ENSMUSP00000073652 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074002] [ENSMUST00000130169]

AlphaFold

Q9ES34

Predicted Effect

probably damaging
Transcript: ENSMUST00000074002
AA Change: L832P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000073652
Gene: ENSMUSG00000029577
AA Change: L832P

Domain	Start	End	E-Value	Type
IQ	28	50	1.17e-2	SMART
low complexity region	310	327	N/A	INTRINSIC
low complexity region	412	428	N/A	INTRINSIC
low complexity region	470	488	N/A	INTRINSIC
HECTc	697	1070	2.15e-110	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000130169

SMART Domains

Protein: ENSMUSP00000138723
Gene: ENSMUSG00000029577

Domain	Start	End	E-Value	Type
IQ	28	50	1.17e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000196651

SMART Domains

Protein: ENSMUSP00000143455
Gene: ENSMUSG00000029577

Domain	Start	End	E-Value	Type
HECTc	122	495	1.1e-112	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 98.9%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit preweaning lethality, reduced fertility, decreased growth, reduced grip strength, impaired hearing, eye inflammation and decreased cholesterol level. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810065E05Rik	T	A	11: 58,423,899	L141Q	probably null	Het
Abtb2	A	T	2: 103,567,375	T217S	probably benign	Het
Adcy1	T	C	11: 7,161,328	I873T	probably damaging	Het
Angpt4	A	G	2: 151,927,085	M172V	probably benign	Het
Apaf1	A	T	10: 90,995,670	V1194D	probably damaging	Het
Arhgap30	T	C	1: 171,407,402	S479P	probably benign	Het
Asah2	C	T	19: 32,052,877	V132M	probably damaging	Het
Bmp10	A	G	6: 87,433,559		probably null	Het
Bsn	T	C	9: 108,106,169	Y790C		Het
Cacna2d1	C	A	5: 16,353,839	R732S	possibly damaging	Het
Casr	A	T	16: 36,495,422	F762Y	possibly damaging	Het
Cbln1	T	C	8: 87,472,107	D45G	possibly damaging	Het
Cd177	A	T	7: 24,760,013	M61K	possibly damaging	Het
Cdh11	T	C	8: 102,650,716	I433V	probably benign	Het
Cdhr5	A	G	7: 141,275,986		probably null	Het
Col12a1	T	A	9: 79,661,076	K1622I	probably benign	Het
Cyp2d9	A	G	15: 82,453,716	D103G	probably damaging	Het
Fem1b	A	T	9: 62,797,150	L276*	probably null	Het
Fggy	T	A	4: 95,812,121	V343E	probably damaging	Het
Flt3	A	G	5: 147,383,455	V33A	probably benign	Het
Gm6904	G	A	14: 59,258,584	T27I	probably benign	Het
Gm8994	A	G	6: 136,329,029	T163A	possibly damaging	Het
Grn	T	C	11: 102,434,820	Y288H	probably benign	Het
Grtp1	G	A	8: 13,179,499	R272W	probably damaging	Het
H2-Aa	A	G	17: 34,283,760	I144T	possibly damaging	Het
Herc1	A	G	9: 66,462,848	D469G		Het
Hsf2	G	A	10: 57,505,171	E286K	possibly damaging	Het
Hydin	A	G	8: 110,309,166	E163G	probably damaging	Het
Il6ra	A	G	3: 89,886,669	I224T	possibly damaging	Het
Itih3	T	A	14: 30,920,716	I204F	possibly damaging	Het
Kcnj9	A	T	1: 172,326,113	M148K	possibly damaging	Het
Lepr	T	G	4: 101,792,072	V890G	probably benign	Het
Mslnl	A	G	17: 25,746,988	D612G	probably benign	Het
Myl2	T	A	5: 122,106,735	V156D	probably damaging	Het
Neb	C	A	2: 52,246,845	W3208L	probably damaging	Het
Neto2	T	C	8: 85,640,666	Y511C	probably benign	Het
Obox2	C	A	7: 15,396,987	T48K	possibly damaging	Het
Olfr1109	A	T	2: 87,093,046	M117K	possibly damaging	Het
Olfr305	C	T	7: 86,364,165	M57I	probably damaging	Het
Olfr568	T	A	7: 102,877,439	F106L	probably benign	Het
Osbpl6	C	G	2: 76,577,081	H486D	probably benign	Het
Pfkfb3	T	C	2: 11,484,333	K264E	probably benign	Het
Pla2r1	T	A	2: 60,422,776	T1324S	possibly damaging	Het
Plekhg1	A	T	10: 3,947,523	Y495F		Het
Ppp2r5d	T	C	17: 46,687,063	K225E	probably benign	Het
Ptpn11	T	C	5: 121,167,990	D64G	possibly damaging	Het
Ptprs	A	G	17: 56,435,849	I431T	probably damaging	Het
Rapgef5	T	C	12: 117,581,812	S100P	probably benign	Het
Rnf219	G	T	14: 104,480,233	R235S	probably damaging	Het
Shh	T	A	5: 28,458,060	H370L	probably benign	Het
Siah3	A	T	14: 75,525,603	H98L	possibly damaging	Het
Sim2	C	T	16: 94,123,333	H446Y	probably benign	Het
Skint4	T	C	4: 112,136,040	I320T	possibly damaging	Het
Sorcs1	A	T	19: 50,378,960	N221K	probably damaging	Het
Sox6	T	C	7: 115,476,956	S816G	probably damaging	Het
Sphkap	T	C	1: 83,279,276	T251A	probably benign	Het
Stard9	T	C	2: 120,703,315	V3351A	possibly damaging	Het
Tbc1d15	A	G	10: 115,210,290	V436A	probably benign	Het
Thsd7b	A	T	1: 129,760,274	K641*	probably null	Het
Tmc5	G	T	7: 118,670,702	V892F	possibly damaging	Het
Tpsab1	T	A	17: 25,343,711	H238L	probably benign	Het
Trank1	A	G	9: 111,365,344	N812S	probably benign	Het
Trio	T	A	15: 27,905,192	N163Y	unknown	Het
Ttc39d	A	G	17: 80,217,264	T451A	probably benign	Het
Vmn2r15	C	A	5: 109,294,072	C165F	probably damaging	Het
Vmn2r90	T	C	17: 17,712,082	F84L	possibly damaging	Het
Wdr60	A	T	12: 116,224,990	H661Q	probably damaging	Het
Wdr95	C	T	5: 149,595,287	T531I	possibly damaging	Het
Zcrb1	C	A	15: 93,386,237	G191V	probably benign	Het
Zfp111	G	A	7: 24,198,558	P544S	probably damaging	Het
Zfyve9	T	C	4: 108,719,342	S181G	probably benign	Het

Other mutations in Ube3b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00754:Ube3b	APN	5	114415287	missense	possibly damaging	0.93
IGL01154:Ube3b	APN	5	114406252	missense	probably null	0.86
IGL02632:Ube3b	APN	5	114398841	missense	probably benign
IGL02850:Ube3b	APN	5	114406249	missense	probably damaging	1.00
IGL02878:Ube3b	APN	5	114404717	splice site	probably null
IGL02881:Ube3b	APN	5	114412884	missense	possibly damaging	0.78
R0003:Ube3b	UTSW	5	114398851	missense	probably benign	0.17
R0071:Ube3b	UTSW	5	114419497	missense	probably damaging	1.00
R0071:Ube3b	UTSW	5	114419497	missense	probably damaging	1.00
R0076:Ube3b	UTSW	5	114408217	critical splice donor site	probably null
R0076:Ube3b	UTSW	5	114408217	critical splice donor site	probably null
R0111:Ube3b	UTSW	5	114390376	splice site	probably benign
R0309:Ube3b	UTSW	5	114419469	splice site	probably benign
R0718:Ube3b	UTSW	5	114402555	nonsense	probably null
R1344:Ube3b	UTSW	5	114418575	missense	probably damaging	1.00
R1350:Ube3b	UTSW	5	114406137	splice site	probably null
R1418:Ube3b	UTSW	5	114418575	missense	probably damaging	1.00
R1732:Ube3b	UTSW	5	114387445	missense	probably benign	0.01
R1764:Ube3b	UTSW	5	114404617	missense	possibly damaging	0.89
R1975:Ube3b	UTSW	5	114399865	missense	possibly damaging	0.80
R2014:Ube3b	UTSW	5	114411149	missense	probably damaging	1.00
R2015:Ube3b	UTSW	5	114411149	missense	probably damaging	1.00
R2041:Ube3b	UTSW	5	114387233	missense	probably damaging	0.99
R2074:Ube3b	UTSW	5	114415255	missense	probably benign	0.14
R2202:Ube3b	UTSW	5	114389074	missense	probably damaging	1.00
R2205:Ube3b	UTSW	5	114389074	missense	probably damaging	1.00
R3826:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3829:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3830:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3927:Ube3b	UTSW	5	114415680	missense	probably benign	0.03
R3974:Ube3b	UTSW	5	114412430	missense	probably benign	0.05
R4049:Ube3b	UTSW	5	114412870	missense	probably benign	0.09
R4096:Ube3b	UTSW	5	114393086	missense	possibly damaging	0.65
R4261:Ube3b	UTSW	5	114398428	missense	possibly damaging	0.80
R4415:Ube3b	UTSW	5	114412444	missense	probably damaging	1.00
R4688:Ube3b	UTSW	5	114393078	missense	probably benign	0.03
R4779:Ube3b	UTSW	5	114404717	splice site	probably null
R4824:Ube3b	UTSW	5	114415726	splice site	probably null
R4868:Ube3b	UTSW	5	114398427	missense	probably benign	0.00
R4953:Ube3b	UTSW	5	114401410	missense	probably benign	0.01
R5013:Ube3b	UTSW	5	114407641	missense	probably damaging	1.00
R5057:Ube3b	UTSW	5	114406257	missense	probably benign	0.01
R5117:Ube3b	UTSW	5	114419631	missense	probably damaging	0.96
R5131:Ube3b	UTSW	5	114407546	missense	probably damaging	1.00
R5498:Ube3b	UTSW	5	114418574	missense	probably damaging	1.00
R5564:Ube3b	UTSW	5	114389075	missense	probably damaging	1.00
R5572:Ube3b	UTSW	5	114406179	missense	probably damaging	0.99
R5580:Ube3b	UTSW	5	114415323	missense	probably benign
R5596:Ube3b	UTSW	5	114406160	splice site	probably null
R5843:Ube3b	UTSW	5	114412299	missense	probably damaging	1.00
R5910:Ube3b	UTSW	5	114415309	missense	possibly damaging	0.63
R6591:Ube3b	UTSW	5	114408124	missense	probably benign	0.00
R6691:Ube3b	UTSW	5	114408124	missense	probably benign	0.00
R7148:Ube3b	UTSW	5	114406252	missense	probably damaging	0.97
R7334:Ube3b	UTSW	5	114415681	missense	possibly damaging	0.64
R7438:Ube3b	UTSW	5	114415284	missense	possibly damaging	0.79
R7438:Ube3b	UTSW	5	114418626	missense	probably damaging	1.00
R7640:Ube3b	UTSW	5	114415323	missense	probably benign
R7825:Ube3b	UTSW	5	114401312	missense	probably damaging	1.00
R7958:Ube3b	UTSW	5	114401423	missense	probably benign	0.05
R8025:Ube3b	UTSW	5	114408209	missense	probably damaging	0.99
R8058:Ube3b	UTSW	5	114406785	missense	possibly damaging	0.58
R8087:Ube3b	UTSW	5	114412489	critical splice donor site	probably null
R8182:Ube3b	UTSW	5	114392138	missense	possibly damaging	0.77
R8322:Ube3b	UTSW	5	114402686	missense	probably benign	0.04
R8465:Ube3b	UTSW	5	114390390	missense	probably damaging	1.00
R8708:Ube3b	UTSW	5	114393090	missense	probably benign	0.34
R8758:Ube3b	UTSW	5	114415200	critical splice acceptor site	probably benign
R8784:Ube3b	UTSW	5	114388739	missense	probably damaging	1.00
R9058:Ube3b	UTSW	5	114415239	missense	probably benign	0.05
R9072:Ube3b	UTSW	5	114404546	missense	probably damaging	0.98
R9116:Ube3b	UTSW	5	114404776	intron	probably benign
R9537:Ube3b	UTSW	5	114387184	missense	probably damaging	1.00
R9596:Ube3b	UTSW	5	114389110	missense	probably damaging	1.00
R9632:Ube3b	UTSW	5	114415309	missense	probably benign	0.00
R9710:Ube3b	UTSW	5	114415309	missense	probably benign	0.00
X0017:Ube3b	UTSW	5	114415585	missense	possibly damaging	0.77

Predicted Primers

PCR Primer
(F):5'- AGGCTGCATGTAGACTCCAC -3'
(R):5'- ACCCATGACGTCTTCATCG -3'

Sequencing Primer
(F):5'- TGCATGTAGACTCCACCAGTG -3'
(R):5'- TCGTAAGACAGCGTCAGC -3'

Posted On

2021-03-08