Incidental Mutation 'R8682:Flt3'
ID 661801
Institutional Source Beutler Lab
Gene Symbol Flt3
Ensembl Gene ENSMUSG00000042817
Gene Name FMS-like tyrosine kinase 3
Synonyms Flt-3, CD135, Flk-2, wmfl, Flk2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8682 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 147330741-147400489 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 147383455 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 33 (V33A)
Ref Sequence ENSEMBL: ENSMUSP00000039041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049324]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000049324
AA Change: V33A

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000039041
Gene: ENSMUSG00000042817
AA Change: V33A

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
IG 79 162 1.87e0 SMART
IG 258 346 2.57e0 SMART
internal_repeat_1 380 529 8.53e-14 PROSPERO
TyrKc 611 946 1.7e-140 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a class III receptor tyrosine kinase that regulates hematopoiesis. This receptor is activated by binding of the fms-related tyrosine kinase 3 ligand to the extracellular domain, which induces homodimer formation in the plasma membrane leading to autophosphorylation of the receptor. The activated receptor kinase subsequently phosphorylates and activates multiple cytoplasmic effector molecules in pathways involved in apoptosis, proliferation, and differentiation of hematopoietic cells in bone marrow. Mutations that result in the constitutive activation of this receptor result in acute myeloid leukemia and acute lymphoblastic leukemia. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice functionally null for this gene display abnormal lymphopoiesis. Homozygous ENU mutant mice are sensitive to infection by mouse cytomegalovirus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T A 11: 58,423,899 L141Q probably null Het
Abtb2 A T 2: 103,567,375 T217S probably benign Het
Adcy1 T C 11: 7,161,328 I873T probably damaging Het
Angpt4 A G 2: 151,927,085 M172V probably benign Het
Apaf1 A T 10: 90,995,670 V1194D probably damaging Het
Arhgap30 T C 1: 171,407,402 S479P probably benign Het
Asah2 C T 19: 32,052,877 V132M probably damaging Het
Bmp10 A G 6: 87,433,559 probably null Het
Bsn T C 9: 108,106,169 Y790C Het
Cacna2d1 C A 5: 16,353,839 R732S possibly damaging Het
Casr A T 16: 36,495,422 F762Y possibly damaging Het
Cbln1 T C 8: 87,472,107 D45G possibly damaging Het
Cd177 A T 7: 24,760,013 M61K possibly damaging Het
Cdh11 T C 8: 102,650,716 I433V probably benign Het
Cdhr5 A G 7: 141,275,986 probably null Het
Col12a1 T A 9: 79,661,076 K1622I probably benign Het
Cyp2d9 A G 15: 82,453,716 D103G probably damaging Het
Fem1b A T 9: 62,797,150 L276* probably null Het
Fggy T A 4: 95,812,121 V343E probably damaging Het
Gm6904 G A 14: 59,258,584 T27I probably benign Het
Gm8994 A G 6: 136,329,029 T163A possibly damaging Het
Grn T C 11: 102,434,820 Y288H probably benign Het
Grtp1 G A 8: 13,179,499 R272W probably damaging Het
H2-Aa A G 17: 34,283,760 I144T possibly damaging Het
Herc1 A G 9: 66,462,848 D469G Het
Hsf2 G A 10: 57,505,171 E286K possibly damaging Het
Hydin A G 8: 110,309,166 E163G probably damaging Het
Il6ra A G 3: 89,886,669 I224T possibly damaging Het
Itih3 T A 14: 30,920,716 I204F possibly damaging Het
Kcnj9 A T 1: 172,326,113 M148K possibly damaging Het
Lepr T G 4: 101,792,072 V890G probably benign Het
Mslnl A G 17: 25,746,988 D612G probably benign Het
Myl2 T A 5: 122,106,735 V156D probably damaging Het
Neb C A 2: 52,246,845 W3208L probably damaging Het
Neto2 T C 8: 85,640,666 Y511C probably benign Het
Obox2 C A 7: 15,396,987 T48K possibly damaging Het
Olfr1109 A T 2: 87,093,046 M117K possibly damaging Het
Olfr305 C T 7: 86,364,165 M57I probably damaging Het
Olfr568 T A 7: 102,877,439 F106L probably benign Het
Osbpl6 C G 2: 76,577,081 H486D probably benign Het
Pfkfb3 T C 2: 11,484,333 K264E probably benign Het
Pla2r1 T A 2: 60,422,776 T1324S possibly damaging Het
Plekhg1 A T 10: 3,947,523 Y495F Het
Ppp2r5d T C 17: 46,687,063 K225E probably benign Het
Ptpn11 T C 5: 121,167,990 D64G possibly damaging Het
Ptprs A G 17: 56,435,849 I431T probably damaging Het
Rapgef5 T C 12: 117,581,812 S100P probably benign Het
Rnf219 G T 14: 104,480,233 R235S probably damaging Het
Shh T A 5: 28,458,060 H370L probably benign Het
Siah3 A T 14: 75,525,603 H98L possibly damaging Het
Sim2 C T 16: 94,123,333 H446Y probably benign Het
Skint4 T C 4: 112,136,040 I320T possibly damaging Het
Sorcs1 A T 19: 50,378,960 N221K probably damaging Het
Sox6 T C 7: 115,476,956 S816G probably damaging Het
Sphkap T C 1: 83,279,276 T251A probably benign Het
Stard9 T C 2: 120,703,315 V3351A possibly damaging Het
Tbc1d15 A G 10: 115,210,290 V436A probably benign Het
Thsd7b A T 1: 129,760,274 K641* probably null Het
Tmc5 G T 7: 118,670,702 V892F possibly damaging Het
Tpsab1 T A 17: 25,343,711 H238L probably benign Het
Trank1 A G 9: 111,365,344 N812S probably benign Het
Trio T A 15: 27,905,192 N163Y unknown Het
Ttc39d A G 17: 80,217,264 T451A probably benign Het
Ube3b T C 5: 114,412,290 L832P probably damaging Het
Vmn2r15 C A 5: 109,294,072 C165F probably damaging Het
Vmn2r90 T C 17: 17,712,082 F84L possibly damaging Het
Wdr60 A T 12: 116,224,990 H661Q probably damaging Het
Wdr95 C T 5: 149,595,287 T531I possibly damaging Het
Zcrb1 C A 15: 93,386,237 G191V probably benign Het
Zfp111 G A 7: 24,198,558 P544S probably damaging Het
Zfyve9 T C 4: 108,719,342 S181G probably benign Het
Other mutations in Flt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Flt3 APN 5 147354876 missense probably damaging 1.00
IGL01083:Flt3 APN 5 147354870 missense probably damaging 1.00
IGL01749:Flt3 APN 5 147358028 missense probably benign 0.02
IGL01765:Flt3 APN 5 147357978 missense probably benign
IGL02109:Flt3 APN 5 147350681 missense probably benign 0.00
IGL02490:Flt3 APN 5 147331296 missense probably damaging 1.00
IGL02631:Flt3 APN 5 147344552 missense probably damaging 1.00
IGL03117:Flt3 APN 5 147356210 missense probably benign
flick UTSW 5 147341238 missense probably damaging 1.00
warmflash UTSW 5 147366918 critical splice donor site probably null
R0070:Flt3 UTSW 5 147372726 splice site probably benign
R0070:Flt3 UTSW 5 147372726 splice site probably benign
R0320:Flt3 UTSW 5 147369579 splice site probably benign
R0347:Flt3 UTSW 5 147357992 missense probably damaging 1.00
R0512:Flt3 UTSW 5 147341270 nonsense probably null
R0968:Flt3 UTSW 5 147341227 missense possibly damaging 0.46
R1180:Flt3 UTSW 5 147341238 missense probably damaging 1.00
R1266:Flt3 UTSW 5 147356860 missense probably benign 0.00
R1562:Flt3 UTSW 5 147344513 missense probably damaging 1.00
R1803:Flt3 UTSW 5 147367055 nonsense probably null
R2000:Flt3 UTSW 5 147341238 missense probably damaging 1.00
R2021:Flt3 UTSW 5 147369490 missense probably damaging 0.98
R2079:Flt3 UTSW 5 147355083 missense probably damaging 0.97
R2261:Flt3 UTSW 5 147348063 missense probably benign 0.00
R2263:Flt3 UTSW 5 147348063 missense probably benign 0.00
R3087:Flt3 UTSW 5 147348046 missense probably benign 0.15
R3727:Flt3 UTSW 5 147354923 missense probably damaging 0.96
R3939:Flt3 UTSW 5 147356243 missense possibly damaging 0.87
R4469:Flt3 UTSW 5 147375644 splice site silent
R4527:Flt3 UTSW 5 147356353 missense probably benign 0.37
R4592:Flt3 UTSW 5 147354699 missense possibly damaging 0.67
R4655:Flt3 UTSW 5 147349593 missense possibly damaging 0.51
R4686:Flt3 UTSW 5 147377048 missense probably damaging 1.00
R4867:Flt3 UTSW 5 147334440 missense probably damaging 1.00
R4897:Flt3 UTSW 5 147369300 missense probably damaging 1.00
R4941:Flt3 UTSW 5 147356375 critical splice acceptor site probably null
R5254:Flt3 UTSW 5 147375690 missense possibly damaging 0.60
R5325:Flt3 UTSW 5 147375649 missense probably benign 0.00
R5395:Flt3 UTSW 5 147354823 missense probably damaging 1.00
R5445:Flt3 UTSW 5 147355095 nonsense probably null
R5469:Flt3 UTSW 5 147355083 missense possibly damaging 0.63
R5556:Flt3 UTSW 5 147332997 splice site probably null
R5660:Flt3 UTSW 5 147369481 missense possibly damaging 0.79
R5879:Flt3 UTSW 5 147334909 missense probably damaging 1.00
R5885:Flt3 UTSW 5 147349629 missense probably damaging 1.00
R6554:Flt3 UTSW 5 147375735 missense probably damaging 0.99
R6813:Flt3 UTSW 5 147354843 missense probably damaging 0.97
R7451:Flt3 UTSW 5 147349667 missense probably damaging 1.00
R7469:Flt3 UTSW 5 147331274 missense probably benign 0.18
R7537:Flt3 UTSW 5 147334437 missense probably damaging 1.00
R7605:Flt3 UTSW 5 147349576 missense probably benign 0.01
R7651:Flt3 UTSW 5 147354922 missense probably damaging 1.00
R7842:Flt3 UTSW 5 147334453 missense probably damaging 1.00
R8051:Flt3 UTSW 5 147358955 intron probably benign
R8236:Flt3 UTSW 5 147356860 missense probably benign 0.00
R8305:Flt3 UTSW 5 147348054 missense probably damaging 0.96
R8337:Flt3 UTSW 5 147332888 critical splice donor site probably null
R8680:Flt3 UTSW 5 147383455 missense probably benign 0.13
R8697:Flt3 UTSW 5 147358001 missense possibly damaging 0.94
R8824:Flt3 UTSW 5 147334863 missense probably damaging 1.00
R8959:Flt3 UTSW 5 147366964 missense possibly damaging 0.93
R9235:Flt3 UTSW 5 147383392 missense possibly damaging 0.89
R9324:Flt3 UTSW 5 147376980 missense probably benign 0.27
R9544:Flt3 UTSW 5 147354632 missense possibly damaging 0.76
R9570:Flt3 UTSW 5 147372614 missense possibly damaging 0.91
R9622:Flt3 UTSW 5 147367031 missense possibly damaging 0.92
R9668:Flt3 UTSW 5 147356884 missense probably benign 0.13
X0018:Flt3 UTSW 5 147367066 missense possibly damaging 0.54
Z1088:Flt3 UTSW 5 147349564 critical splice donor site probably null
Z1177:Flt3 UTSW 5 147383401 missense probably benign 0.27
Z31818:Flt3 UTSW 5 147366918 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCATGGTAGCAAGGAAGCTG -3'
(R):5'- TGCCCTGCTGTCATTCAGAG -3'

Sequencing Primer
(F):5'- AAGCTGGCAGTATAGTGTTTGGAAC -3'
(R):5'- CCCGTACCAACGTCATTAT -3'
Posted On 2021-03-08