Mutagenetix > Incidental Mutations

Incidental Mutation 'R8682:Bmp10'

661803

Institutional Source

Beutler Lab

Gene Symbol

Bmp10

Ensembl Gene

ENSMUSG00000030046

Gene Name

bone morphogenetic protein 10

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8682 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

87428994-87437677 bp(+) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

A to G at 87433559 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000032125 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032125]

AlphaFold

Q9R229

Predicted Effect

probably null
Transcript: ENSMUST00000032125

SMART Domains

Protein: ENSMUSP00000032125
Gene: ENSMUSG00000030046

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:TGFb_propeptide	52	256	8.1e-24	PFAM
TGFB	320	420	6.7e-52	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 98.9%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate the mature protein, which binds to the activin receptor-like kinase 1 (ALK1) and plays important roles in cardiovascular development including cardiomyocyte proliferation and regulation of heart size, closure of the ductus arteriosus, angiogenesis and ventricular trabeculation. Homozygous knockout mice for this gene exhibit impaired heart development and embryonic lethality. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice display decreased embryo size, cardiac dysgenesis, defects in early embryonic vascular development, enlarged pericardium, arteriovenous malformations, and embryonic lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810065E05Rik	T	A	11: 58,423,899	L141Q	probably null	Het
Abtb2	A	T	2: 103,567,375	T217S	probably benign	Het
Adcy1	T	C	11: 7,161,328	I873T	probably damaging	Het
Angpt4	A	G	2: 151,927,085	M172V	probably benign	Het
Apaf1	A	T	10: 90,995,670	V1194D	probably damaging	Het
Arhgap30	T	C	1: 171,407,402	S479P	probably benign	Het
Asah2	C	T	19: 32,052,877	V132M	probably damaging	Het
Bsn	T	C	9: 108,106,169	Y790C		Het
Cacna2d1	C	A	5: 16,353,839	R732S	possibly damaging	Het
Casr	A	T	16: 36,495,422	F762Y	possibly damaging	Het
Cbln1	T	C	8: 87,472,107	D45G	possibly damaging	Het
Cd177	A	T	7: 24,760,013	M61K	possibly damaging	Het
Cdh11	T	C	8: 102,650,716	I433V	probably benign	Het
Cdhr5	A	G	7: 141,275,986		probably null	Het
Col12a1	T	A	9: 79,661,076	K1622I	probably benign	Het
Cyp2d9	A	G	15: 82,453,716	D103G	probably damaging	Het
Fem1b	A	T	9: 62,797,150	L276*	probably null	Het
Fggy	T	A	4: 95,812,121	V343E	probably damaging	Het
Flt3	A	G	5: 147,383,455	V33A	probably benign	Het
Gm6904	G	A	14: 59,258,584	T27I	probably benign	Het
Gm8994	A	G	6: 136,329,029	T163A	possibly damaging	Het
Grn	T	C	11: 102,434,820	Y288H	probably benign	Het
Grtp1	G	A	8: 13,179,499	R272W	probably damaging	Het
H2-Aa	A	G	17: 34,283,760	I144T	possibly damaging	Het
Herc1	A	G	9: 66,462,848	D469G		Het
Hsf2	G	A	10: 57,505,171	E286K	possibly damaging	Het
Hydin	A	G	8: 110,309,166	E163G	probably damaging	Het
Il6ra	A	G	3: 89,886,669	I224T	possibly damaging	Het
Itih3	T	A	14: 30,920,716	I204F	possibly damaging	Het
Kcnj9	A	T	1: 172,326,113	M148K	possibly damaging	Het
Lepr	T	G	4: 101,792,072	V890G	probably benign	Het
Mslnl	A	G	17: 25,746,988	D612G	probably benign	Het
Myl2	T	A	5: 122,106,735	V156D	probably damaging	Het
Neb	C	A	2: 52,246,845	W3208L	probably damaging	Het
Neto2	T	C	8: 85,640,666	Y511C	probably benign	Het
Obox2	C	A	7: 15,396,987	T48K	possibly damaging	Het
Olfr1109	A	T	2: 87,093,046	M117K	possibly damaging	Het
Olfr305	C	T	7: 86,364,165	M57I	probably damaging	Het
Olfr568	T	A	7: 102,877,439	F106L	probably benign	Het
Osbpl6	C	G	2: 76,577,081	H486D	probably benign	Het
Pfkfb3	T	C	2: 11,484,333	K264E	probably benign	Het
Pla2r1	T	A	2: 60,422,776	T1324S	possibly damaging	Het
Plekhg1	A	T	10: 3,947,523	Y495F		Het
Ppp2r5d	T	C	17: 46,687,063	K225E	probably benign	Het
Ptpn11	T	C	5: 121,167,990	D64G	possibly damaging	Het
Ptprs	A	G	17: 56,435,849	I431T	probably damaging	Het
Rapgef5	T	C	12: 117,581,812	S100P	probably benign	Het
Rnf219	G	T	14: 104,480,233	R235S	probably damaging	Het
Shh	T	A	5: 28,458,060	H370L	probably benign	Het
Siah3	A	T	14: 75,525,603	H98L	possibly damaging	Het
Sim2	C	T	16: 94,123,333	H446Y	probably benign	Het
Skint4	T	C	4: 112,136,040	I320T	possibly damaging	Het
Sorcs1	A	T	19: 50,378,960	N221K	probably damaging	Het
Sox6	T	C	7: 115,476,956	S816G	probably damaging	Het
Sphkap	T	C	1: 83,279,276	T251A	probably benign	Het
Stard9	T	C	2: 120,703,315	V3351A	possibly damaging	Het
Tbc1d15	A	G	10: 115,210,290	V436A	probably benign	Het
Thsd7b	A	T	1: 129,760,274	K641*	probably null	Het
Tmc5	G	T	7: 118,670,702	V892F	possibly damaging	Het
Tpsab1	T	A	17: 25,343,711	H238L	probably benign	Het
Trank1	A	G	9: 111,365,344	N812S	probably benign	Het
Trio	T	A	15: 27,905,192	N163Y	unknown	Het
Ttc39d	A	G	17: 80,217,264	T451A	probably benign	Het
Ube3b	T	C	5: 114,412,290	L832P	probably damaging	Het
Vmn2r15	C	A	5: 109,294,072	C165F	probably damaging	Het
Vmn2r90	T	C	17: 17,712,082	F84L	possibly damaging	Het
Wdr60	A	T	12: 116,224,990	H661Q	probably damaging	Het
Wdr95	C	T	5: 149,595,287	T531I	possibly damaging	Het
Zcrb1	C	A	15: 93,386,237	G191V	probably benign	Het
Zfp111	G	A	7: 24,198,558	P544S	probably damaging	Het
Zfyve9	T	C	4: 108,719,342	S181G	probably benign	Het

Other mutations in Bmp10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00916:Bmp10	APN	6	87429160	missense	possibly damaging	0.87
IGL00946:Bmp10	APN	6	87434362	missense	probably damaging	1.00
IGL01483:Bmp10	APN	6	87433951	missense	probably damaging	1.00
IGL02132:Bmp10	APN	6	87434148	missense	probably benign
R1391:Bmp10	UTSW	6	87433758	missense	probably benign	0.00
R1472:Bmp10	UTSW	6	87433797	missense	probably benign	0.34
R1938:Bmp10	UTSW	6	87433720	missense	possibly damaging	0.77
R2114:Bmp10	UTSW	6	87434459	missense	probably benign	0.10
R2158:Bmp10	UTSW	6	87434080	missense	probably benign	0.21
R4922:Bmp10	UTSW	6	87433575	missense	probably benign	0.00
R5042:Bmp10	UTSW	6	87434057	missense	probably damaging	0.98
R6041:Bmp10	UTSW	6	87434320	missense	probably damaging	1.00
R7000:Bmp10	UTSW	6	87434193	missense	probably benign	0.02
R7593:Bmp10	UTSW	6	87433669	missense	probably damaging	1.00
R8844:Bmp10	UTSW	6	87433699	missense	probably damaging	1.00
R9378:Bmp10	UTSW	6	87433702	missense	probably benign	0.19

Predicted Primers

PCR Primer
(F):5'- TCCTTGTGAAGTAGCTCAGGC -3'
(R):5'- CTAAGACCAGCATGCTCCTC -3'

Sequencing Primer
(F):5'- GGTTTTACTGCTGTGAACAGACACC -3'
(R):5'- TGCACTCTCTAGTACCTCAAAAATGG -3'

Posted On

2021-03-08