Mutagenetix > Incidental Mutation

Incidental Mutation 'R8682:Sox6'

661810

Institutional Source

Beutler Lab

Gene Symbol

Sox6

Ensembl Gene

ENSMUSG00000051910

Gene Name

SRY (sex determining region Y)-box 6

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8682 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

115470872-116038796 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 115476956 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 816 (S816G)

Ref Sequence

ENSEMBL: ENSMUSP00000072583 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072804] [ENSMUST00000106612] [ENSMUST00000166207] [ENSMUST00000166877] [ENSMUST00000169129] [ENSMUST00000205405] [ENSMUST00000206034] [ENSMUST00000206369]

AlphaFold

P40645

Predicted Effect

probably damaging
Transcript: ENSMUST00000072804
AA Change: S816G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000072583
Gene: ENSMUSG00000051910
AA Change: S816G

Domain	Start	End	E-Value	Type
coiled coil region	184	261	N/A	INTRINSIC
low complexity region	462	484	N/A	INTRINSIC
low complexity region	507	517	N/A	INTRINSIC
HMG	619	689	1.5e-25	SMART
low complexity region	797	809	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000106612
AA Change: S774G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000102223
Gene: ENSMUSG00000051910
AA Change: S774G

Domain	Start	End	E-Value	Type
coiled coil region	184	261	N/A	INTRINSIC
low complexity region	323	333	N/A	INTRINSIC
low complexity region	420	442	N/A	INTRINSIC
low complexity region	465	475	N/A	INTRINSIC
HMG	577	647	1.5e-25	SMART
low complexity region	755	767	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000166207
AA Change: S816G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000129027
Gene: ENSMUSG00000051910
AA Change: S816G

Domain	Start	End	E-Value	Type
coiled coil region	184	261	N/A	INTRINSIC
low complexity region	462	484	N/A	INTRINSIC
low complexity region	507	517	N/A	INTRINSIC
HMG	619	689	1.5e-25	SMART
low complexity region	797	809	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000166877
AA Change: S776G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000129512
Gene: ENSMUSG00000051910
AA Change: S776G

Domain	Start	End	E-Value	Type
coiled coil region	184	263	N/A	INTRINSIC
low complexity region	324	335	N/A	INTRINSIC
low complexity region	422	444	N/A	INTRINSIC
low complexity region	467	477	N/A	INTRINSIC
HMG	579	649	1.5e-25	SMART
low complexity region	757	769	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000169129
AA Change: S776G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000126404
Gene: ENSMUSG00000051910
AA Change: S776G

Domain	Start	End	E-Value	Type
coiled coil region	184	263	N/A	INTRINSIC
low complexity region	324	335	N/A	INTRINSIC
low complexity region	422	444	N/A	INTRINSIC
low complexity region	467	477	N/A	INTRINSIC
HMG	579	649	1.5e-25	SMART
low complexity region	757	769	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000205405
AA Change: S817G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000206034
AA Change: S775G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

Predicted Effect

probably damaging
Transcript: ENSMUST00000206369
AA Change: S817G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 98.9%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of a family of transcriptional regulators containing high mobility group (HMG) DNA-binding domains. Function of the encoded protein is important for proper cardiac and skeletal development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygotes for null mutations exhibit cardioskeletal myopathy, cardiac blockage, delayed growth, and early postnatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810065E05Rik	T	A	11: 58,423,899	L141Q	probably null	Het
Abtb2	A	T	2: 103,567,375	T217S	probably benign	Het
Adcy1	T	C	11: 7,161,328	I873T	probably damaging	Het
Angpt4	A	G	2: 151,927,085	M172V	probably benign	Het
Apaf1	A	T	10: 90,995,670	V1194D	probably damaging	Het
Arhgap30	T	C	1: 171,407,402	S479P	probably benign	Het
Asah2	C	T	19: 32,052,877	V132M	probably damaging	Het
Bmp10	A	G	6: 87,433,559		probably null	Het
Bsn	T	C	9: 108,106,169	Y790C		Het
Cacna2d1	C	A	5: 16,353,839	R732S	possibly damaging	Het
Casr	A	T	16: 36,495,422	F762Y	possibly damaging	Het
Cbln1	T	C	8: 87,472,107	D45G	possibly damaging	Het
Cd177	A	T	7: 24,760,013	M61K	possibly damaging	Het
Cdh11	T	C	8: 102,650,716	I433V	probably benign	Het
Cdhr5	A	G	7: 141,275,986		probably null	Het
Col12a1	T	A	9: 79,661,076	K1622I	probably benign	Het
Cyp2d9	A	G	15: 82,453,716	D103G	probably damaging	Het
Fem1b	A	T	9: 62,797,150	L276*	probably null	Het
Fggy	T	A	4: 95,812,121	V343E	probably damaging	Het
Flt3	A	G	5: 147,383,455	V33A	probably benign	Het
Gm6904	G	A	14: 59,258,584	T27I	probably benign	Het
Gm8994	A	G	6: 136,329,029	T163A	possibly damaging	Het
Grn	T	C	11: 102,434,820	Y288H	probably benign	Het
Grtp1	G	A	8: 13,179,499	R272W	probably damaging	Het
H2-Aa	A	G	17: 34,283,760	I144T	possibly damaging	Het
Herc1	A	G	9: 66,462,848	D469G		Het
Hsf2	G	A	10: 57,505,171	E286K	possibly damaging	Het
Hydin	A	G	8: 110,309,166	E163G	probably damaging	Het
Il6ra	A	G	3: 89,886,669	I224T	possibly damaging	Het
Itih3	T	A	14: 30,920,716	I204F	possibly damaging	Het
Kcnj9	A	T	1: 172,326,113	M148K	possibly damaging	Het
Lepr	T	G	4: 101,792,072	V890G	probably benign	Het
Mslnl	A	G	17: 25,746,988	D612G	probably benign	Het
Myl2	T	A	5: 122,106,735	V156D	probably damaging	Het
Neb	C	A	2: 52,246,845	W3208L	probably damaging	Het
Neto2	T	C	8: 85,640,666	Y511C	probably benign	Het
Obox2	C	A	7: 15,396,987	T48K	possibly damaging	Het
Olfr1109	A	T	2: 87,093,046	M117K	possibly damaging	Het
Olfr305	C	T	7: 86,364,165	M57I	probably damaging	Het
Olfr568	T	A	7: 102,877,439	F106L	probably benign	Het
Osbpl6	C	G	2: 76,577,081	H486D	probably benign	Het
Pfkfb3	T	C	2: 11,484,333	K264E	probably benign	Het
Pla2r1	T	A	2: 60,422,776	T1324S	possibly damaging	Het
Plekhg1	A	T	10: 3,947,523	Y495F		Het
Ppp2r5d	T	C	17: 46,687,063	K225E	probably benign	Het
Ptpn11	T	C	5: 121,167,990	D64G	possibly damaging	Het
Ptprs	A	G	17: 56,435,849	I431T	probably damaging	Het
Rapgef5	T	C	12: 117,581,812	S100P	probably benign	Het
Rnf219	G	T	14: 104,480,233	R235S	probably damaging	Het
Shh	T	A	5: 28,458,060	H370L	probably benign	Het
Siah3	A	T	14: 75,525,603	H98L	possibly damaging	Het
Sim2	C	T	16: 94,123,333	H446Y	probably benign	Het
Skint4	T	C	4: 112,136,040	I320T	possibly damaging	Het
Sorcs1	A	T	19: 50,378,960	N221K	probably damaging	Het
Sphkap	T	C	1: 83,279,276	T251A	probably benign	Het
Stard9	T	C	2: 120,703,315	V3351A	possibly damaging	Het
Tbc1d15	A	G	10: 115,210,290	V436A	probably benign	Het
Thsd7b	A	T	1: 129,760,274	K641*	probably null	Het
Tmc5	G	T	7: 118,670,702	V892F	possibly damaging	Het
Tpsab1	T	A	17: 25,343,711	H238L	probably benign	Het
Trank1	A	G	9: 111,365,344	N812S	probably benign	Het
Trio	T	A	15: 27,905,192	N163Y	unknown	Het
Ttc39d	A	G	17: 80,217,264	T451A	probably benign	Het
Ube3b	T	C	5: 114,412,290	L832P	probably damaging	Het
Vmn2r15	C	A	5: 109,294,072	C165F	probably damaging	Het
Vmn2r90	T	C	17: 17,712,082	F84L	possibly damaging	Het
Wdr60	A	T	12: 116,224,990	H661Q	probably damaging	Het
Wdr95	C	T	5: 149,595,287	T531I	possibly damaging	Het
Zcrb1	C	A	15: 93,386,237	G191V	probably benign	Het
Zfp111	G	A	7: 24,198,558	P544S	probably damaging	Het
Zfyve9	T	C	4: 108,719,342	S181G	probably benign	Het

Other mutations in Sox6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00518:Sox6	APN	7	115477206	missense	probably benign
IGL00957:Sox6	APN	7	115777092	missense	probably damaging	1.00
IGL01624:Sox6	APN	7	115476968	missense	probably damaging	1.00
IGL02057:Sox6	APN	7	115550075	missense	probably damaging	1.00
IGL02385:Sox6	APN	7	115550039	missense	possibly damaging	0.77
IGL02410:Sox6	APN	7	115486744	missense	probably damaging	1.00
IGL02736:Sox6	APN	7	115580640	missense	probably damaging	1.00
IGL02747:Sox6	APN	7	115489746	missense	probably damaging	1.00
IGL02792:Sox6	APN	7	115541649	missense	probably benign
PIT4480001:Sox6	UTSW	7	115597509	missense	probably benign	0.03
R0458:Sox6	UTSW	7	115489794	missense	probably damaging	1.00
R0689:Sox6	UTSW	7	115486551	missense	probably damaging	1.00
R0800:Sox6	UTSW	7	115579014	critical splice donor site	probably null
R1220:Sox6	UTSW	7	115662442	missense	probably damaging	1.00
R1474:Sox6	UTSW	7	115701691	splice site	probably benign
R1547:Sox6	UTSW	7	115701722	missense	possibly damaging	0.93
R1570:Sox6	UTSW	7	115777123	missense	probably damaging	1.00
R1674:Sox6	UTSW	7	115801419	missense	probably benign	0.00
R1704:Sox6	UTSW	7	115476948	missense	possibly damaging	0.92
R1754:Sox6	UTSW	7	115477055	missense	probably benign
R1833:Sox6	UTSW	7	115777093	missense	probably damaging	1.00
R1868:Sox6	UTSW	7	115659538	missense	possibly damaging	0.89
R1893:Sox6	UTSW	7	115544568	missense	probably benign	0.28
R2386:Sox6	UTSW	7	115597505	missense	probably damaging	1.00
R2431:Sox6	UTSW	7	115550007	splice site	probably null
R4303:Sox6	UTSW	7	115544469	critical splice donor site	probably null
R4319:Sox6	UTSW	7	115580563	critical splice donor site	probably null
R4320:Sox6	UTSW	7	115580563	critical splice donor site	probably null
R4321:Sox6	UTSW	7	115580563	critical splice donor site	probably null
R4323:Sox6	UTSW	7	115580563	critical splice donor site	probably null
R4335:Sox6	UTSW	7	115512724	missense	probably benign
R4567:Sox6	UTSW	7	115662322	missense	probably benign	0.26
R4776:Sox6	UTSW	7	115541670	missense	probably damaging	1.00
R4838:Sox6	UTSW	7	115486662	missense	probably damaging	1.00
R4914:Sox6	UTSW	7	115476964	missense	probably damaging	1.00
R4915:Sox6	UTSW	7	115476964	missense	probably damaging	1.00
R5184:Sox6	UTSW	7	115777228	missense	probably damaging	1.00
R5372:Sox6	UTSW	7	115550151	nonsense	probably null
R5454:Sox6	UTSW	7	115701773	missense	possibly damaging	0.89
R5663:Sox6	UTSW	7	115550054	missense	probably benign
R5685:Sox6	UTSW	7	115579157	splice site	probably null
R5734:Sox6	UTSW	7	115541621	critical splice donor site	probably null
R6020:Sox6	UTSW	7	115486628	missense	probably damaging	1.00
R6211:Sox6	UTSW	7	115801462	missense	probably damaging	1.00
R6263:Sox6	UTSW	7	115477060	missense	probably damaging	1.00
R6549:Sox6	UTSW	7	115486692	missense	possibly damaging	0.79
R6576:Sox6	UTSW	7	115701702	missense	probably damaging	0.96
R6680:Sox6	UTSW	7	115476983	missense	possibly damaging	0.94
R6709:Sox6	UTSW	7	115701789	splice site	probably null
R6747:Sox6	UTSW	7	115541731	missense	probably damaging	1.00
R6755:Sox6	UTSW	7	115662442	missense	probably damaging	0.99
R7233:Sox6	UTSW	7	115489809	missense	possibly damaging	0.80
R7423:Sox6	UTSW	7	115550023	missense	probably benign	0.30
R7455:Sox6	UTSW	7	115489669	missense	probably benign	0.02
R7522:Sox6	UTSW	7	115801578	missense	probably damaging	1.00
R7527:Sox6	UTSW	7	115777173	missense	probably benign	0.00
R7852:Sox6	UTSW	7	115801604	start codon destroyed	probably null	1.00
R7936:Sox6	UTSW	7	115544595	missense	probably benign
R8278:Sox6	UTSW	7	115476964	missense	probably damaging	1.00
R8335:Sox6	UTSW	7	115701714	missense	probably damaging	1.00
R8558:Sox6	UTSW	7	115541798	missense	probably benign	0.12
R8693:Sox6	UTSW	7	115662397	missense	probably damaging	0.99
R8712:Sox6	UTSW	7	115597508	missense	probably benign	0.00
R8972:Sox6	UTSW	7	115476983	nonsense	probably null
R9297:Sox6	UTSW	7	115662322	missense	probably benign	0.26
R9318:Sox6	UTSW	7	115662322	missense	probably benign	0.26
R9517:Sox6	UTSW	7	115512735	missense	possibly damaging	0.79
R9688:Sox6	UTSW	7	115476990	missense	probably benign
X0061:Sox6	UTSW	7	115477148	missense	probably benign	0.00
X0065:Sox6	UTSW	7	115550108	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCTGTCTCACACGTTACGAAG -3'
(R):5'- GCTATTACTATGGCAACGACCAC -3'

Sequencing Primer
(F):5'- CGAAGCAATTAAGACCATTCTGCTG -3'
(R):5'- TACTATGGCAACGACCACACCATC -3'

Posted On

2021-03-08