Incidental Mutation 'R8682:Neto2'
ID 661814
Institutional Source Beutler Lab
Gene Symbol Neto2
Ensembl Gene ENSMUSG00000036902
Gene Name neuropilin (NRP) and tolloid (TLL)-like 2
Synonyms 5530601C23Rik
MMRRC Submission 068537-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.157) question?
Stock # R8682 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 86363217-86427553 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 86367295 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 511 (Y511C)
Ref Sequence ENSEMBL: ENSMUSP00000105308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109686] [ENSMUST00000209479] [ENSMUST00000216286]
AlphaFold Q8BNJ6
Predicted Effect probably benign
Transcript: ENSMUST00000109686
AA Change: Y511C

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000105308
Gene: ENSMUSG00000036902
AA Change: Y511C

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
CUB 80 194 2.56e-40 SMART
CUB 205 320 9.11e-5 SMART
LDLa 324 361 5.73e-5 SMART
transmembrane domain 374 396 N/A INTRINSIC
coiled coil region 432 460 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209479
AA Change: Y476C

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000216286
AA Change: Y483C

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a predicted transmembrane protein containing two extracellular CUB domains followed by a low-density lipoprotein class A (LDLa) domain. A similar gene in rats encodes a protein that modulates glutamate signaling in the brain by regulating kainate receptor function. Expression of this gene may be a biomarker for proliferating infantile hemangiomas. A pseudogene of this gene is located on the long arm of chromosome 8. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a null mutation show normal brain morphology and kainate receptor mediated excitatory postsynaptic currents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T A 11: 58,314,725 (GRCm39) L141Q probably null Het
Abtb2 A T 2: 103,397,720 (GRCm39) T217S probably benign Het
Adcy1 T C 11: 7,111,328 (GRCm39) I873T probably damaging Het
Angpt4 A G 2: 151,769,005 (GRCm39) M172V probably benign Het
Apaf1 A T 10: 90,831,532 (GRCm39) V1194D probably damaging Het
Arhgap30 T C 1: 171,234,970 (GRCm39) S479P probably benign Het
Asah2 C T 19: 32,030,277 (GRCm39) V132M probably damaging Het
Bmp10 A G 6: 87,410,541 (GRCm39) probably null Het
Bsn T C 9: 107,983,368 (GRCm39) Y790C Het
Cacna2d1 C A 5: 16,558,837 (GRCm39) R732S possibly damaging Het
Casr A T 16: 36,315,784 (GRCm39) F762Y possibly damaging Het
Cbln1 T C 8: 88,198,735 (GRCm39) D45G possibly damaging Het
Cd177 A T 7: 24,459,438 (GRCm39) M61K possibly damaging Het
Cdh11 T C 8: 103,377,348 (GRCm39) I433V probably benign Het
Cdhr5 A G 7: 140,855,899 (GRCm39) probably null Het
Col12a1 T A 9: 79,568,358 (GRCm39) K1622I probably benign Het
Cyp2d9 A G 15: 82,337,917 (GRCm39) D103G probably damaging Het
Dync2i1 A T 12: 116,188,610 (GRCm39) H661Q probably damaging Het
Eif4a3l1 A G 6: 136,306,027 (GRCm39) T163A possibly damaging Het
Fem1b A T 9: 62,704,432 (GRCm39) L276* probably null Het
Fggy T A 4: 95,700,358 (GRCm39) V343E probably damaging Het
Flt3 A G 5: 147,320,265 (GRCm39) V33A probably benign Het
Grn T C 11: 102,325,646 (GRCm39) Y288H probably benign Het
Grtp1 G A 8: 13,229,499 (GRCm39) R272W probably damaging Het
H2-Aa A G 17: 34,502,734 (GRCm39) I144T possibly damaging Het
Herc1 A G 9: 66,370,130 (GRCm39) D469G Het
Hsf2 G A 10: 57,381,267 (GRCm39) E286K possibly damaging Het
Hydin A G 8: 111,035,798 (GRCm39) E163G probably damaging Het
Il6ra A G 3: 89,793,976 (GRCm39) I224T possibly damaging Het
Itih3 T A 14: 30,642,673 (GRCm39) I204F possibly damaging Het
Kcnj9 A T 1: 172,153,680 (GRCm39) M148K possibly damaging Het
Lepr T G 4: 101,649,269 (GRCm39) V890G probably benign Het
Mslnl A G 17: 25,965,962 (GRCm39) D612G probably benign Het
Myl2 T A 5: 122,244,798 (GRCm39) V156D probably damaging Het
Neb C A 2: 52,136,857 (GRCm39) W3208L probably damaging Het
Obi1 G T 14: 104,717,669 (GRCm39) R235S probably damaging Het
Obox2 C A 7: 15,130,912 (GRCm39) T48K possibly damaging Het
Or14a259 C T 7: 86,013,373 (GRCm39) M57I probably damaging Het
Or51f2 T A 7: 102,526,646 (GRCm39) F106L probably benign Het
Or5aq6 A T 2: 86,923,390 (GRCm39) M117K possibly damaging Het
Osbpl6 C G 2: 76,407,425 (GRCm39) H486D probably benign Het
Pfkfb3 T C 2: 11,489,144 (GRCm39) K264E probably benign Het
Phf11 G A 14: 59,496,033 (GRCm39) T27I probably benign Het
Pla2r1 T A 2: 60,253,120 (GRCm39) T1324S possibly damaging Het
Plekhg1 A T 10: 3,897,523 (GRCm39) Y495F Het
Ppp2r5d T C 17: 46,997,989 (GRCm39) K225E probably benign Het
Ptpn11 T C 5: 121,306,053 (GRCm39) D64G possibly damaging Het
Ptprs A G 17: 56,742,849 (GRCm39) I431T probably damaging Het
Rapgef5 T C 12: 117,545,432 (GRCm39) S100P probably benign Het
Shh T A 5: 28,663,058 (GRCm39) H370L probably benign Het
Siah3 A T 14: 75,763,043 (GRCm39) H98L possibly damaging Het
Sim2 C T 16: 93,924,192 (GRCm39) H446Y probably benign Het
Skint4 T C 4: 111,993,237 (GRCm39) I320T possibly damaging Het
Sorcs1 A T 19: 50,367,398 (GRCm39) N221K probably damaging Het
Sox6 T C 7: 115,076,191 (GRCm39) S816G probably damaging Het
Sphkap T C 1: 83,256,997 (GRCm39) T251A probably benign Het
Stard9 T C 2: 120,533,796 (GRCm39) V3351A possibly damaging Het
Tbc1d15 A G 10: 115,046,195 (GRCm39) V436A probably benign Het
Thsd7b A T 1: 129,688,011 (GRCm39) K641* probably null Het
Tmc5 G T 7: 118,269,925 (GRCm39) V892F possibly damaging Het
Tpsab1 T A 17: 25,562,685 (GRCm39) H238L probably benign Het
Trank1 A G 9: 111,194,412 (GRCm39) N812S probably benign Het
Trio T A 15: 27,905,278 (GRCm39) N163Y unknown Het
Ttc39d A G 17: 80,524,693 (GRCm39) T451A probably benign Het
Ube3b T C 5: 114,550,351 (GRCm39) L832P probably damaging Het
Vmn2r15 C A 5: 109,441,938 (GRCm39) C165F probably damaging Het
Vmn2r90 T C 17: 17,932,344 (GRCm39) F84L possibly damaging Het
Wdr95 C T 5: 149,518,752 (GRCm39) T531I possibly damaging Het
Zcrb1 C A 15: 93,284,118 (GRCm39) G191V probably benign Het
Zfp111 G A 7: 23,897,983 (GRCm39) P544S probably damaging Het
Zfyve9 T C 4: 108,576,539 (GRCm39) S181G probably benign Het
Other mutations in Neto2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01705:Neto2 APN 8 86,367,632 (GRCm39) missense probably damaging 1.00
IGL01938:Neto2 APN 8 86,417,484 (GRCm39) missense probably benign 0.00
IGL02238:Neto2 APN 8 86,396,292 (GRCm39) missense probably damaging 0.99
IGL02605:Neto2 APN 8 86,390,064 (GRCm39) splice site probably benign
IGL02813:Neto2 APN 8 86,417,515 (GRCm39) missense probably benign
R0138:Neto2 UTSW 8 86,367,673 (GRCm39) missense possibly damaging 0.72
R1934:Neto2 UTSW 8 86,397,033 (GRCm39) missense possibly damaging 0.96
R2402:Neto2 UTSW 8 86,417,541 (GRCm39) missense probably benign 0.00
R2423:Neto2 UTSW 8 86,396,396 (GRCm39) missense probably damaging 1.00
R3821:Neto2 UTSW 8 86,389,924 (GRCm39) nonsense probably null
R3822:Neto2 UTSW 8 86,389,924 (GRCm39) nonsense probably null
R3883:Neto2 UTSW 8 86,389,894 (GRCm39) missense probably damaging 1.00
R3939:Neto2 UTSW 8 86,400,747 (GRCm39) missense probably damaging 0.99
R3940:Neto2 UTSW 8 86,400,747 (GRCm39) missense probably damaging 0.99
R3941:Neto2 UTSW 8 86,400,747 (GRCm39) missense probably damaging 0.99
R4433:Neto2 UTSW 8 86,367,712 (GRCm39) missense probably damaging 1.00
R4668:Neto2 UTSW 8 86,367,691 (GRCm39) missense probably damaging 1.00
R4675:Neto2 UTSW 8 86,396,333 (GRCm39) missense probably damaging 1.00
R4908:Neto2 UTSW 8 86,396,393 (GRCm39) missense probably damaging 0.99
R5459:Neto2 UTSW 8 86,397,112 (GRCm39) missense probably benign 0.35
R5471:Neto2 UTSW 8 86,367,389 (GRCm39) missense probably benign 0.41
R5544:Neto2 UTSW 8 86,374,506 (GRCm39) missense possibly damaging 0.94
R5571:Neto2 UTSW 8 86,367,173 (GRCm39) missense probably damaging 1.00
R6083:Neto2 UTSW 8 86,367,214 (GRCm39) missense probably benign 0.00
R6339:Neto2 UTSW 8 86,367,187 (GRCm39) missense probably benign 0.33
R6381:Neto2 UTSW 8 86,369,138 (GRCm39) missense probably damaging 0.99
R6572:Neto2 UTSW 8 86,397,033 (GRCm39) missense possibly damaging 0.96
R6593:Neto2 UTSW 8 86,396,175 (GRCm39) missense probably damaging 1.00
R6662:Neto2 UTSW 8 86,389,844 (GRCm39) missense probably damaging 1.00
R6881:Neto2 UTSW 8 86,367,185 (GRCm39) missense probably damaging 1.00
R6950:Neto2 UTSW 8 86,397,072 (GRCm39) missense probably damaging 1.00
R7121:Neto2 UTSW 8 86,397,020 (GRCm39) splice site probably null
R7754:Neto2 UTSW 8 86,396,329 (GRCm39) missense probably damaging 0.98
R7755:Neto2 UTSW 8 86,396,285 (GRCm39) missense probably damaging 1.00
R9326:Neto2 UTSW 8 86,369,063 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTGTAGGCTGCATACACAC -3'
(R):5'- TCTGCAGATCTGGCAGATTTG -3'

Sequencing Primer
(F):5'- GGTGTAGGCTGCATACACACTTAAC -3'
(R):5'- ACTACCAGAAGTTGCGGC -3'
Posted On 2021-03-08