Incidental Mutation 'R8682:Bsn'
ID661821
Institutional Source Beutler Lab
Gene Symbol Bsn
Ensembl Gene ENSMUSG00000032589
Gene Namebassoon
Synonymspresynaptic cytomatrix protein
Accession Numbers

Genbank: NM_007567; MGI: 1277955

Is this an essential gene? Possibly non essential (E-score: 0.376) question?
Stock #R8682 (G1)
Quality Score134.008
Status Not validated
Chromosome9
Chromosomal Location108096022-108190384 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108106169 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 790 (Y790C)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035208]
Predicted Effect unknown
Transcript: ENSMUST00000035208
AA Change: Y3562C
SMART Domains Protein: ENSMUSP00000035208
Gene: ENSMUSG00000032589
AA Change: Y3562C

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
low complexity region 42 77 N/A INTRINSIC
Pfam:zf-piccolo 165 223 6.1e-30 PFAM
low complexity region 394 409 N/A INTRINSIC
low complexity region 445 454 N/A INTRINSIC
Pfam:zf-piccolo 462 520 5.2e-31 PFAM
low complexity region 527 540 N/A INTRINSIC
low complexity region 627 643 N/A INTRINSIC
low complexity region 664 681 N/A INTRINSIC
low complexity region 694 708 N/A INTRINSIC
low complexity region 788 803 N/A INTRINSIC
low complexity region 994 1021 N/A INTRINSIC
coiled coil region 1047 1101 N/A INTRINSIC
low complexity region 1131 1145 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1333 1343 N/A INTRINSIC
low complexity region 1443 1455 N/A INTRINSIC
low complexity region 1481 1498 N/A INTRINSIC
low complexity region 1790 1800 N/A INTRINSIC
low complexity region 2117 2126 N/A INTRINSIC
low complexity region 2287 2303 N/A INTRINSIC
low complexity region 2326 2356 N/A INTRINSIC
SCOP:d1eq1a_ 2362 2477 2e-7 SMART
low complexity region 2607 2614 N/A INTRINSIC
low complexity region 2635 2651 N/A INTRINSIC
low complexity region 2655 2672 N/A INTRINSIC
coiled coil region 2949 2990 N/A INTRINSIC
low complexity region 3057 3071 N/A INTRINSIC
low complexity region 3089 3114 N/A INTRINSIC
low complexity region 3446 3461 N/A INTRINSIC
low complexity region 3520 3534 N/A INTRINSIC
low complexity region 3653 3666 N/A INTRINSIC
low complexity region 3750 3820 N/A INTRINSIC
low complexity region 3831 3852 N/A INTRINSIC
low complexity region 3856 3901 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurotransmitters are released from a specific site in the axon terminal called the active zone, which is composed of synaptic vesicles and a meshwork of cytoskeleton underlying the plasma membrane. The protein encoded by this gene is thought to be a scaffolding protein involved in organizing the presynaptic cytoskeleton. The gene is expressed primarily in neurons in the brain. A similar gene product in rodents is concentrated in the active zone of axon terminals and tightly associated with cytoskeletal structures, and is essential for regulating neurotransmitter release from a subset of synapses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants lacking functional protein exhibit impaired hippocampal and photoreceptor synaptic transmission, aberrant photoreceptor ribbon synapse formation, and spontaneous epileptic seizures. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, other(1) Gene trapped(8)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T A 11: 58,423,899 L141Q probably null Het
Abtb2 A T 2: 103,567,375 T217S probably benign Het
Adcy1 T C 11: 7,161,328 I873T probably damaging Het
Angpt4 A G 2: 151,927,085 M172V probably benign Het
Apaf1 A T 10: 90,995,670 V1194D probably damaging Het
Arhgap30 T C 1: 171,407,402 S479P probably benign Het
Asah2 C T 19: 32,052,877 V132M probably damaging Het
Bmp10 A G 6: 87,433,559 probably null Het
Cacna2d1 C A 5: 16,353,839 R732S possibly damaging Het
Casr A T 16: 36,495,422 F762Y possibly damaging Het
Cbln1 T C 8: 87,472,107 D45G possibly damaging Het
Cd177 A T 7: 24,760,013 M61K possibly damaging Het
Cdh11 T C 8: 102,650,716 I433V probably benign Het
Cdhr5 A G 7: 141,275,986 probably null Het
Col12a1 T A 9: 79,661,076 K1622I probably benign Het
Cyp2d9 A G 15: 82,453,716 D103G probably damaging Het
Fem1b A T 9: 62,797,150 L276* probably null Het
Fggy T A 4: 95,812,121 V343E probably damaging Het
Flt3 A G 5: 147,383,455 V33A probably benign Het
Gm6904 G A 14: 59,258,584 T27I probably benign Het
Gm8994 A G 6: 136,329,029 T163A possibly damaging Het
Grn T C 11: 102,434,820 Y288H probably benign Het
Grtp1 G A 8: 13,179,499 R272W probably damaging Het
H2-Aa A G 17: 34,283,760 I144T possibly damaging Het
Herc1 A G 9: 66,462,848 D469G Het
Hsf2 G A 10: 57,505,171 E286K possibly damaging Het
Hydin A G 8: 110,309,166 E163G probably damaging Het
Il6ra A G 3: 89,886,669 I224T possibly damaging Het
Itih3 T A 14: 30,920,716 I204F possibly damaging Het
Kcnj9 A T 1: 172,326,113 M148K possibly damaging Het
Lepr T G 4: 101,792,072 V890G probably benign Het
Mslnl A G 17: 25,746,988 D612G probably benign Het
Myl2 T A 5: 122,106,735 V156D probably damaging Het
Neb C A 2: 52,246,845 W3208L probably damaging Het
Neto2 T C 8: 85,640,666 Y511C probably benign Het
Obox2 C A 7: 15,396,987 T48K possibly damaging Het
Olfr1109 A T 2: 87,093,046 M117K possibly damaging Het
Olfr305 C T 7: 86,364,165 M57I probably damaging Het
Olfr568 T A 7: 102,877,439 F106L probably benign Het
Osbpl6 C G 2: 76,577,081 H486D probably benign Het
Pfkfb3 T C 2: 11,484,333 K264E probably benign Het
Pla2r1 T A 2: 60,422,776 T1324S possibly damaging Het
Plekhg1 A T 10: 3,947,523 Y495F Het
Ppp2r5d T C 17: 46,687,063 K225E probably benign Het
Ptpn11 T C 5: 121,167,990 D64G possibly damaging Het
Ptprs A G 17: 56,435,849 I431T probably damaging Het
Rapgef5 T C 12: 117,581,812 S100P probably benign Het
Rnf219 G T 14: 104,480,233 R235S probably damaging Het
Shh T A 5: 28,458,060 H370L probably benign Het
Siah3 A T 14: 75,525,603 H98L possibly damaging Het
Sim2 C T 16: 94,123,333 H446Y probably benign Het
Skint4 T C 4: 112,136,040 I320T possibly damaging Het
Sorcs1 A T 19: 50,378,960 N221K probably damaging Het
Sox6 T C 7: 115,476,956 S816G probably damaging Het
Sphkap T C 1: 83,279,276 T251A probably benign Het
Stard9 T C 2: 120,703,315 V3351A possibly damaging Het
Tbc1d15 A G 10: 115,210,290 V436A probably benign Het
Thsd7b A T 1: 129,760,274 K641* probably null Het
Tmc5 G T 7: 118,670,702 V892F possibly damaging Het
Tpsab1 T A 17: 25,343,711 H238L probably benign Het
Trank1 A G 9: 111,365,344 N812S probably benign Het
Trio T A 15: 27,905,192 N163Y unknown Het
Ttc39d A G 17: 80,217,264 T451A probably benign Het
Ube3b T C 5: 114,412,290 L832P probably damaging Het
Vmn2r15 C A 5: 109,294,072 C165F probably damaging Het
Vmn2r90 T C 17: 17,712,082 F84L possibly damaging Het
Wdr60 A T 12: 116,224,990 H661Q probably damaging Het
Wdr95 C T 5: 149,595,287 T531I possibly damaging Het
Zcrb1 C A 15: 93,386,237 G191V probably benign Het
Zfp111 G A 7: 24,198,558 P544S probably damaging Het
Zfyve9 T C 4: 108,719,342 S181G probably benign Het
Other mutations in Bsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Bsn APN 9 108115110 missense probably benign 0.01
IGL00330:Bsn APN 9 108115340 missense probably damaging 1.00
IGL00863:Bsn APN 9 108115322 missense probably damaging 1.00
IGL01123:Bsn APN 9 108115986 missense probably damaging 1.00
IGL01330:Bsn APN 9 108110913 unclassified probably benign
IGL01336:Bsn APN 9 108111785 missense probably damaging 0.99
IGL01399:Bsn APN 9 108107187 missense unknown
IGL01683:Bsn APN 9 108114896 missense possibly damaging 0.71
IGL02022:Bsn APN 9 108110418 unclassified probably benign
IGL02396:Bsn APN 9 108116046 missense possibly damaging 0.90
IGL02538:Bsn APN 9 108105236 missense unknown
IGL02565:Bsn APN 9 108113288 missense probably damaging 0.99
IGL02661:Bsn APN 9 108106936 nonsense probably null
IGL02739:Bsn APN 9 108112546 missense probably benign 0.14
IGL02951:Bsn APN 9 108115613 missense probably damaging 1.00
IGL02987:Bsn APN 9 108126304 missense probably benign 0.03
IGL03033:Bsn APN 9 108115993 missense probably damaging 1.00
IGL03069:Bsn APN 9 108114263 missense probably damaging 1.00
IGL03076:Bsn APN 9 108105382 missense unknown
R0068:Bsn UTSW 9 108112137 missense probably damaging 1.00
R0068:Bsn UTSW 9 108112137 missense probably damaging 1.00
R0167:Bsn UTSW 9 108125986 missense probably benign 0.01
R0234:Bsn UTSW 9 108116396 missense possibly damaging 0.50
R0234:Bsn UTSW 9 108116396 missense possibly damaging 0.50
R0359:Bsn UTSW 9 108111846 missense possibly damaging 0.81
R0514:Bsn UTSW 9 108125782 missense probably benign 0.07
R0593:Bsn UTSW 9 108110306 missense unknown
R0617:Bsn UTSW 9 108107240 missense unknown
R0636:Bsn UTSW 9 108107834 missense unknown
R0652:Bsn UTSW 9 108105742 missense unknown
R0718:Bsn UTSW 9 108111360 unclassified probably benign
R0730:Bsn UTSW 9 108106812 missense unknown
R0905:Bsn UTSW 9 108105635 missense unknown
R0963:Bsn UTSW 9 108111807 missense possibly damaging 0.81
R0992:Bsn UTSW 9 108114354 nonsense probably null
R1101:Bsn UTSW 9 108116411 missense probably damaging 1.00
R1393:Bsn UTSW 9 108110517 unclassified probably benign
R1490:Bsn UTSW 9 108113994 missense probably benign 0.03
R1566:Bsn UTSW 9 108125985 missense probably benign 0.35
R1582:Bsn UTSW 9 108105092 missense unknown
R1738:Bsn UTSW 9 108106934 missense unknown
R1867:Bsn UTSW 9 108106719 missense unknown
R1918:Bsn UTSW 9 108107573 missense unknown
R1933:Bsn UTSW 9 108116444 missense possibly damaging 0.91
R1946:Bsn UTSW 9 108114651 missense probably damaging 0.99
R1978:Bsn UTSW 9 108114549 missense probably benign 0.35
R2068:Bsn UTSW 9 108110684 unclassified probably benign
R2068:Bsn UTSW 9 108126550 missense possibly damaging 0.95
R2113:Bsn UTSW 9 108114886 missense probably benign 0.14
R2136:Bsn UTSW 9 108113231 missense probably damaging 1.00
R2172:Bsn UTSW 9 108109992 intron probably benign
R2266:Bsn UTSW 9 108115124 missense probably damaging 1.00
R2293:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2294:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2368:Bsn UTSW 9 108111030 nonsense probably null
R2442:Bsn UTSW 9 108106920 missense unknown
R2507:Bsn UTSW 9 108116114 missense probably damaging 1.00
R2880:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2881:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2922:Bsn UTSW 9 108108186 missense unknown
R2922:Bsn UTSW 9 108115469 missense probably damaging 1.00
R3618:Bsn UTSW 9 108117561 critical splice acceptor site probably null
R3742:Bsn UTSW 9 108105739 missense unknown
R3825:Bsn UTSW 9 108106856 missense unknown
R3982:Bsn UTSW 9 108107166 missense unknown
R4094:Bsn UTSW 9 108113870 missense probably damaging 1.00
R4158:Bsn UTSW 9 108112946 missense possibly damaging 0.95
R4225:Bsn UTSW 9 108106733 missense unknown
R4261:Bsn UTSW 9 108110684 unclassified probably benign
R4482:Bsn UTSW 9 108114664 missense probably damaging 1.00
R4515:Bsn UTSW 9 108104078 splice site probably null
R4585:Bsn UTSW 9 108110463 unclassified probably benign
R4628:Bsn UTSW 9 108113235 missense probably damaging 1.00
R4636:Bsn UTSW 9 108115424 missense probably damaging 1.00
R4679:Bsn UTSW 9 108110130 missense unknown
R4723:Bsn UTSW 9 108112655 missense probably benign 0.03
R4843:Bsn UTSW 9 108107189 missense unknown
R4885:Bsn UTSW 9 108107527 nonsense probably null
R4936:Bsn UTSW 9 108111761 missense probably damaging 1.00
R4942:Bsn UTSW 9 108106479 missense unknown
R4972:Bsn UTSW 9 108115178 missense probably damaging 1.00
R4992:Bsn UTSW 9 108115548 missense probably damaging 1.00
R5067:Bsn UTSW 9 108111953 missense probably damaging 1.00
R5206:Bsn UTSW 9 108105373 missense unknown
R5286:Bsn UTSW 9 108110924 unclassified probably benign
R5492:Bsn UTSW 9 108112515 missense probably damaging 0.98
R5553:Bsn UTSW 9 108110421 unclassified probably benign
R5561:Bsn UTSW 9 108105511 missense unknown
R5597:Bsn UTSW 9 108114932 missense probably benign 0.06
R5646:Bsn UTSW 9 108110432 unclassified probably benign
R5796:Bsn UTSW 9 108126024 missense probably damaging 1.00
R5801:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R5802:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R5850:Bsn UTSW 9 108114950 missense probably damaging 0.99
R5938:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R6221:Bsn UTSW 9 108105566 missense unknown
R6243:Bsn UTSW 9 108107561 missense unknown
R6254:Bsn UTSW 9 108111866 missense probably damaging 0.96
R6263:Bsn UTSW 9 108113254 missense probably damaging 1.00
R6345:Bsn UTSW 9 108107355 missense unknown
R6368:Bsn UTSW 9 108111314 unclassified probably benign
R6574:Bsn UTSW 9 108113954 missense possibly damaging 0.95
R6793:Bsn UTSW 9 108114615 nonsense probably null
R6802:Bsn UTSW 9 108110624 unclassified probably benign
R6943:Bsn UTSW 9 108107817 missense unknown
R6999:Bsn UTSW 9 108113433 missense probably benign 0.00
R7149:Bsn UTSW 9 108116321 nonsense probably null
R7199:Bsn UTSW 9 108115334 missense probably damaging 1.00
R7322:Bsn UTSW 9 108126421 nonsense probably null
R7349:Bsn UTSW 9 108110783 missense unknown
R7372:Bsn UTSW 9 108110519 missense unknown
R7373:Bsn UTSW 9 108113484 missense probably damaging 1.00
R7413:Bsn UTSW 9 108139491 missense possibly damaging 0.61
R7473:Bsn UTSW 9 108112250 missense probably damaging 1.00
R7482:Bsn UTSW 9 108113529 missense probably damaging 0.98
R7530:Bsn UTSW 9 108111956 missense probably damaging 1.00
R7549:Bsn UTSW 9 108114815 missense probably benign 0.05
R7570:Bsn UTSW 9 108113543 missense probably damaging 1.00
R7635:Bsn UTSW 9 108110990 missense unknown
R7696:Bsn UTSW 9 108114501 missense probably damaging 1.00
R7757:Bsn UTSW 9 108114740 missense possibly damaging 0.90
R7868:Bsn UTSW 9 108114899 missense possibly damaging 0.95
R7897:Bsn UTSW 9 108111866 missense probably damaging 0.98
R7960:Bsn UTSW 9 108115548 missense probably damaging 1.00
R8022:Bsn UTSW 9 108114404 missense probably benign 0.01
R8056:Bsn UTSW 9 108105307 missense
R8158:Bsn UTSW 9 108110033 missense unknown
R8161:Bsn UTSW 9 108139530 missense probably benign 0.20
R8225:Bsn UTSW 9 108107106 missense
R8282:Bsn UTSW 9 108107691 missense possibly damaging 0.73
R8296:Bsn UTSW 9 108117379 missense probably benign 0.00
R8415:Bsn UTSW 9 108111452 missense probably benign 0.00
R8417:Bsn UTSW 9 108111452 missense probably benign 0.00
R8426:Bsn UTSW 9 108126573 missense probably damaging 1.00
R8437:Bsn UTSW 9 108111452 missense probably benign 0.00
R8438:Bsn UTSW 9 108111452 missense probably benign 0.00
R8439:Bsn UTSW 9 108111452 missense probably benign 0.00
R8440:Bsn UTSW 9 108111452 missense probably benign 0.00
R8441:Bsn UTSW 9 108111452 missense probably benign 0.00
R8442:Bsn UTSW 9 108111452 missense probably benign 0.00
R8513:Bsn UTSW 9 108114510 missense possibly damaging 0.65
R8529:Bsn UTSW 9 108111452 missense probably benign 0.00
R8535:Bsn UTSW 9 108111452 missense probably benign 0.00
R8546:Bsn UTSW 9 108111452 missense probably benign 0.00
R8548:Bsn UTSW 9 108111452 missense probably benign 0.00
R8549:Bsn UTSW 9 108111452 missense probably benign 0.00
R8773:Bsn UTSW 9 108110505 missense unknown
X0028:Bsn UTSW 9 108113504 missense probably damaging 1.00
X0066:Bsn UTSW 9 108139210 missense probably damaging 1.00
Z1177:Bsn UTSW 9 108105499 missense
Z1177:Bsn UTSW 9 108139195 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACTGATGAGATGCCAAGAC -3'
(R):5'- GCAGAGCGACTTCAAAAGGC -3'

Sequencing Primer
(F):5'- TGAGATGCCAAGACAGACCCTG -3'
(R):5'- ACTTCAAAAGGCGGGCTC -3'
Posted On2021-03-08