Incidental Mutation 'R8682:Trank1'
ID 661822
Institutional Source Beutler Lab
Gene Symbol Trank1
Ensembl Gene ENSMUSG00000062296
Gene Name tetratricopeptide repeat and ankyrin repeat containing 1
Synonyms LOC235639, C030048J01Rik, A230061D21Rik, Lba1
MMRRC Submission 068537-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8682 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 111140807-111224843 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 111194412 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 812 (N812S)
Ref Sequence ENSEMBL: ENSMUSP00000077697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078626]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000078626
AA Change: N812S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000077697
Gene: ENSMUSG00000062296
AA Change: N812S

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
low complexity region 34 52 N/A INTRINSIC
low complexity region 113 129 N/A INTRINSIC
Blast:TPR 144 177 1e-15 BLAST
Blast:TPR 178 209 8e-13 BLAST
Blast:ANK 332 361 1e-6 BLAST
ANK 369 405 5.29e0 SMART
ANK 538 567 2.11e2 SMART
ANK 572 609 7.29e2 SMART
ANK 621 652 1.21e2 SMART
low complexity region 887 895 N/A INTRINSIC
low complexity region 1152 1172 N/A INTRINSIC
Blast:AAA 1351 1569 1e-6 BLAST
low complexity region 2166 2177 N/A INTRINSIC
low complexity region 2395 2411 N/A INTRINSIC
low complexity region 2636 2649 N/A INTRINSIC
low complexity region 2966 2983 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T A 11: 58,314,725 (GRCm39) L141Q probably null Het
Abtb2 A T 2: 103,397,720 (GRCm39) T217S probably benign Het
Adcy1 T C 11: 7,111,328 (GRCm39) I873T probably damaging Het
Angpt4 A G 2: 151,769,005 (GRCm39) M172V probably benign Het
Apaf1 A T 10: 90,831,532 (GRCm39) V1194D probably damaging Het
Arhgap30 T C 1: 171,234,970 (GRCm39) S479P probably benign Het
Asah2 C T 19: 32,030,277 (GRCm39) V132M probably damaging Het
Bmp10 A G 6: 87,410,541 (GRCm39) probably null Het
Bsn T C 9: 107,983,368 (GRCm39) Y790C Het
Cacna2d1 C A 5: 16,558,837 (GRCm39) R732S possibly damaging Het
Casr A T 16: 36,315,784 (GRCm39) F762Y possibly damaging Het
Cbln1 T C 8: 88,198,735 (GRCm39) D45G possibly damaging Het
Cd177 A T 7: 24,459,438 (GRCm39) M61K possibly damaging Het
Cdh11 T C 8: 103,377,348 (GRCm39) I433V probably benign Het
Cdhr5 A G 7: 140,855,899 (GRCm39) probably null Het
Col12a1 T A 9: 79,568,358 (GRCm39) K1622I probably benign Het
Cyp2d9 A G 15: 82,337,917 (GRCm39) D103G probably damaging Het
Dync2i1 A T 12: 116,188,610 (GRCm39) H661Q probably damaging Het
Eif4a3l1 A G 6: 136,306,027 (GRCm39) T163A possibly damaging Het
Fem1b A T 9: 62,704,432 (GRCm39) L276* probably null Het
Fggy T A 4: 95,700,358 (GRCm39) V343E probably damaging Het
Flt3 A G 5: 147,320,265 (GRCm39) V33A probably benign Het
Grn T C 11: 102,325,646 (GRCm39) Y288H probably benign Het
Grtp1 G A 8: 13,229,499 (GRCm39) R272W probably damaging Het
H2-Aa A G 17: 34,502,734 (GRCm39) I144T possibly damaging Het
Herc1 A G 9: 66,370,130 (GRCm39) D469G Het
Hsf2 G A 10: 57,381,267 (GRCm39) E286K possibly damaging Het
Hydin A G 8: 111,035,798 (GRCm39) E163G probably damaging Het
Il6ra A G 3: 89,793,976 (GRCm39) I224T possibly damaging Het
Itih3 T A 14: 30,642,673 (GRCm39) I204F possibly damaging Het
Kcnj9 A T 1: 172,153,680 (GRCm39) M148K possibly damaging Het
Lepr T G 4: 101,649,269 (GRCm39) V890G probably benign Het
Mslnl A G 17: 25,965,962 (GRCm39) D612G probably benign Het
Myl2 T A 5: 122,244,798 (GRCm39) V156D probably damaging Het
Neb C A 2: 52,136,857 (GRCm39) W3208L probably damaging Het
Neto2 T C 8: 86,367,295 (GRCm39) Y511C probably benign Het
Obi1 G T 14: 104,717,669 (GRCm39) R235S probably damaging Het
Obox2 C A 7: 15,130,912 (GRCm39) T48K possibly damaging Het
Or14a259 C T 7: 86,013,373 (GRCm39) M57I probably damaging Het
Or51f2 T A 7: 102,526,646 (GRCm39) F106L probably benign Het
Or5aq6 A T 2: 86,923,390 (GRCm39) M117K possibly damaging Het
Osbpl6 C G 2: 76,407,425 (GRCm39) H486D probably benign Het
Pfkfb3 T C 2: 11,489,144 (GRCm39) K264E probably benign Het
Phf11 G A 14: 59,496,033 (GRCm39) T27I probably benign Het
Pla2r1 T A 2: 60,253,120 (GRCm39) T1324S possibly damaging Het
Plekhg1 A T 10: 3,897,523 (GRCm39) Y495F Het
Ppp2r5d T C 17: 46,997,989 (GRCm39) K225E probably benign Het
Ptpn11 T C 5: 121,306,053 (GRCm39) D64G possibly damaging Het
Ptprs A G 17: 56,742,849 (GRCm39) I431T probably damaging Het
Rapgef5 T C 12: 117,545,432 (GRCm39) S100P probably benign Het
Shh T A 5: 28,663,058 (GRCm39) H370L probably benign Het
Siah3 A T 14: 75,763,043 (GRCm39) H98L possibly damaging Het
Sim2 C T 16: 93,924,192 (GRCm39) H446Y probably benign Het
Skint4 T C 4: 111,993,237 (GRCm39) I320T possibly damaging Het
Sorcs1 A T 19: 50,367,398 (GRCm39) N221K probably damaging Het
Sox6 T C 7: 115,076,191 (GRCm39) S816G probably damaging Het
Sphkap T C 1: 83,256,997 (GRCm39) T251A probably benign Het
Stard9 T C 2: 120,533,796 (GRCm39) V3351A possibly damaging Het
Tbc1d15 A G 10: 115,046,195 (GRCm39) V436A probably benign Het
Thsd7b A T 1: 129,688,011 (GRCm39) K641* probably null Het
Tmc5 G T 7: 118,269,925 (GRCm39) V892F possibly damaging Het
Tpsab1 T A 17: 25,562,685 (GRCm39) H238L probably benign Het
Trio T A 15: 27,905,278 (GRCm39) N163Y unknown Het
Ttc39d A G 17: 80,524,693 (GRCm39) T451A probably benign Het
Ube3b T C 5: 114,550,351 (GRCm39) L832P probably damaging Het
Vmn2r15 C A 5: 109,441,938 (GRCm39) C165F probably damaging Het
Vmn2r90 T C 17: 17,932,344 (GRCm39) F84L possibly damaging Het
Wdr95 C T 5: 149,518,752 (GRCm39) T531I possibly damaging Het
Zcrb1 C A 15: 93,284,118 (GRCm39) G191V probably benign Het
Zfp111 G A 7: 23,897,983 (GRCm39) P544S probably damaging Het
Zfyve9 T C 4: 108,576,539 (GRCm39) S181G probably benign Het
Other mutations in Trank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Trank1 APN 9 111,221,677 (GRCm39) missense probably damaging 1.00
IGL00467:Trank1 APN 9 111,193,734 (GRCm39) splice site probably benign
IGL00569:Trank1 APN 9 111,174,579 (GRCm39) missense possibly damaging 0.69
IGL00585:Trank1 APN 9 111,178,358 (GRCm39) missense possibly damaging 0.82
IGL01070:Trank1 APN 9 111,195,861 (GRCm39) missense probably damaging 1.00
IGL01134:Trank1 APN 9 111,220,849 (GRCm39) missense probably benign
IGL01154:Trank1 APN 9 111,215,468 (GRCm39) missense probably benign 0.00
IGL01355:Trank1 APN 9 111,194,588 (GRCm39) missense possibly damaging 0.94
IGL01407:Trank1 APN 9 111,193,790 (GRCm39) missense probably damaging 0.99
IGL01410:Trank1 APN 9 111,194,117 (GRCm39) missense probably benign 0.00
IGL01410:Trank1 APN 9 111,194,327 (GRCm39) missense probably benign 0.00
IGL01504:Trank1 APN 9 111,202,612 (GRCm39) missense probably damaging 1.00
IGL01744:Trank1 APN 9 111,178,431 (GRCm39) missense probably damaging 1.00
IGL02043:Trank1 APN 9 111,193,028 (GRCm39) missense probably damaging 0.98
IGL02104:Trank1 APN 9 111,219,780 (GRCm39) missense possibly damaging 0.85
IGL02193:Trank1 APN 9 111,196,344 (GRCm39) missense probably benign 0.43
IGL02581:Trank1 APN 9 111,212,193 (GRCm39) missense probably benign 0.00
IGL02630:Trank1 APN 9 111,202,143 (GRCm39) missense possibly damaging 0.70
IGL02839:Trank1 APN 9 111,193,824 (GRCm39) missense probably damaging 1.00
IGL02897:Trank1 APN 9 111,196,585 (GRCm39) missense probably damaging 0.99
IGL03065:Trank1 APN 9 111,219,361 (GRCm39) missense possibly damaging 0.64
IGL03123:Trank1 APN 9 111,196,475 (GRCm39) missense probably damaging 1.00
IGL03143:Trank1 APN 9 111,195,155 (GRCm39) missense probably damaging 1.00
IGL03323:Trank1 APN 9 111,181,184 (GRCm39) missense probably damaging 1.00
1mM(1):Trank1 UTSW 9 111,222,049 (GRCm39) missense probably damaging 1.00
PIT4486001:Trank1 UTSW 9 111,219,175 (GRCm39) missense probably damaging 1.00
PIT4812001:Trank1 UTSW 9 111,176,980 (GRCm39) missense probably damaging 1.00
R0035:Trank1 UTSW 9 111,195,844 (GRCm39) missense probably benign 0.00
R0064:Trank1 UTSW 9 111,172,263 (GRCm39) missense probably damaging 1.00
R0064:Trank1 UTSW 9 111,172,263 (GRCm39) missense probably damaging 1.00
R0089:Trank1 UTSW 9 111,221,978 (GRCm39) missense probably benign 0.00
R0207:Trank1 UTSW 9 111,195,321 (GRCm39) missense probably damaging 1.00
R0255:Trank1 UTSW 9 111,195,092 (GRCm39) missense possibly damaging 0.92
R0334:Trank1 UTSW 9 111,222,008 (GRCm39) missense probably damaging 1.00
R0334:Trank1 UTSW 9 111,194,421 (GRCm39) missense probably benign 0.00
R0383:Trank1 UTSW 9 111,220,545 (GRCm39) missense probably benign 0.08
R0421:Trank1 UTSW 9 111,220,907 (GRCm39) missense probably damaging 1.00
R0494:Trank1 UTSW 9 111,220,361 (GRCm39) missense probably benign 0.19
R0518:Trank1 UTSW 9 111,162,876 (GRCm39) missense probably damaging 1.00
R0560:Trank1 UTSW 9 111,220,154 (GRCm39) missense possibly damaging 0.88
R0637:Trank1 UTSW 9 111,219,509 (GRCm39) missense probably damaging 1.00
R0731:Trank1 UTSW 9 111,194,556 (GRCm39) missense probably damaging 1.00
R0761:Trank1 UTSW 9 111,195,681 (GRCm39) missense probably damaging 1.00
R0766:Trank1 UTSW 9 111,176,537 (GRCm39) missense probably benign 0.45
R0827:Trank1 UTSW 9 111,178,485 (GRCm39) unclassified probably benign
R1005:Trank1 UTSW 9 111,162,789 (GRCm39) missense probably benign 0.13
R1108:Trank1 UTSW 9 111,194,375 (GRCm39) missense probably benign 0.00
R1155:Trank1 UTSW 9 111,196,038 (GRCm39) missense possibly damaging 0.95
R1470:Trank1 UTSW 9 111,172,300 (GRCm39) missense possibly damaging 0.91
R1470:Trank1 UTSW 9 111,172,300 (GRCm39) missense possibly damaging 0.91
R1596:Trank1 UTSW 9 111,195,358 (GRCm39) missense possibly damaging 0.93
R1601:Trank1 UTSW 9 111,202,545 (GRCm39) missense probably damaging 1.00
R1751:Trank1 UTSW 9 111,220,547 (GRCm39) missense probably benign
R1754:Trank1 UTSW 9 111,221,939 (GRCm39) missense probably benign 0.00
R1767:Trank1 UTSW 9 111,220,547 (GRCm39) missense probably benign
R1768:Trank1 UTSW 9 111,221,995 (GRCm39) missense probably damaging 0.96
R1809:Trank1 UTSW 9 111,221,893 (GRCm39) missense probably benign 0.34
R1912:Trank1 UTSW 9 111,219,777 (GRCm39) missense probably benign 0.00
R1920:Trank1 UTSW 9 111,176,996 (GRCm39) critical splice donor site probably null
R1960:Trank1 UTSW 9 111,220,696 (GRCm39) missense probably damaging 1.00
R1993:Trank1 UTSW 9 111,207,900 (GRCm39) missense probably benign 0.20
R2012:Trank1 UTSW 9 111,194,096 (GRCm39) missense probably benign
R2025:Trank1 UTSW 9 111,221,107 (GRCm39) missense probably benign 0.01
R2050:Trank1 UTSW 9 111,193,856 (GRCm39) missense probably damaging 1.00
R2857:Trank1 UTSW 9 111,196,001 (GRCm39) missense probably benign 0.00
R2912:Trank1 UTSW 9 111,221,551 (GRCm39) missense probably damaging 0.98
R2962:Trank1 UTSW 9 111,181,148 (GRCm39) missense probably damaging 1.00
R3030:Trank1 UTSW 9 111,220,598 (GRCm39) missense possibly damaging 0.63
R3821:Trank1 UTSW 9 111,207,887 (GRCm39) missense probably damaging 1.00
R3822:Trank1 UTSW 9 111,207,887 (GRCm39) missense probably damaging 1.00
R3892:Trank1 UTSW 9 111,193,827 (GRCm39) missense probably benign 0.03
R4105:Trank1 UTSW 9 111,181,265 (GRCm39) missense probably damaging 1.00
R4166:Trank1 UTSW 9 111,202,592 (GRCm39) nonsense probably null
R4237:Trank1 UTSW 9 111,196,103 (GRCm39) missense probably benign 0.04
R4239:Trank1 UTSW 9 111,196,103 (GRCm39) missense probably benign 0.04
R4394:Trank1 UTSW 9 111,194,265 (GRCm39) missense possibly damaging 0.86
R4417:Trank1 UTSW 9 111,195,036 (GRCm39) missense probably benign 0.17
R4611:Trank1 UTSW 9 111,191,329 (GRCm39) missense probably damaging 1.00
R4694:Trank1 UTSW 9 111,221,129 (GRCm39) missense probably benign 0.40
R4731:Trank1 UTSW 9 111,219,478 (GRCm39) missense probably damaging 1.00
R4843:Trank1 UTSW 9 111,195,146 (GRCm39) missense probably benign 0.00
R4852:Trank1 UTSW 9 111,220,963 (GRCm39) missense possibly damaging 0.68
R4859:Trank1 UTSW 9 111,194,078 (GRCm39) missense probably benign 0.17
R4868:Trank1 UTSW 9 111,194,709 (GRCm39) missense probably damaging 1.00
R5080:Trank1 UTSW 9 111,218,289 (GRCm39) missense probably damaging 0.99
R5156:Trank1 UTSW 9 111,219,762 (GRCm39) missense probably damaging 1.00
R5174:Trank1 UTSW 9 111,194,627 (GRCm39) missense probably benign 0.00
R5234:Trank1 UTSW 9 111,215,535 (GRCm39) missense probably damaging 1.00
R5386:Trank1 UTSW 9 111,191,470 (GRCm39) missense probably benign 0.12
R5419:Trank1 UTSW 9 111,220,369 (GRCm39) missense probably damaging 1.00
R5435:Trank1 UTSW 9 111,220,958 (GRCm39) missense probably benign 0.00
R5444:Trank1 UTSW 9 111,222,026 (GRCm39) missense probably benign 0.04
R5543:Trank1 UTSW 9 111,195,180 (GRCm39) missense probably damaging 0.97
R5560:Trank1 UTSW 9 111,219,635 (GRCm39) missense probably damaging 1.00
R5772:Trank1 UTSW 9 111,195,744 (GRCm39) missense possibly damaging 0.86
R5774:Trank1 UTSW 9 111,220,294 (GRCm39) missense probably damaging 1.00
R5843:Trank1 UTSW 9 111,194,928 (GRCm39) missense possibly damaging 0.59
R5858:Trank1 UTSW 9 111,221,604 (GRCm39) missense probably benign
R5878:Trank1 UTSW 9 111,195,753 (GRCm39) missense possibly damaging 0.93
R5900:Trank1 UTSW 9 111,220,784 (GRCm39) missense probably damaging 1.00
R5917:Trank1 UTSW 9 111,191,485 (GRCm39) missense probably benign 0.38
R5954:Trank1 UTSW 9 111,194,201 (GRCm39) missense probably benign 0.13
R6041:Trank1 UTSW 9 111,206,864 (GRCm39) missense possibly damaging 0.94
R6112:Trank1 UTSW 9 111,220,805 (GRCm39) missense probably damaging 1.00
R6165:Trank1 UTSW 9 111,220,940 (GRCm39) missense probably benign 0.00
R6255:Trank1 UTSW 9 111,181,314 (GRCm39) critical splice donor site probably null
R6395:Trank1 UTSW 9 111,196,268 (GRCm39) missense probably damaging 1.00
R6567:Trank1 UTSW 9 111,176,589 (GRCm39) missense probably benign 0.02
R6644:Trank1 UTSW 9 111,193,902 (GRCm39) missense possibly damaging 0.85
R6724:Trank1 UTSW 9 111,194,984 (GRCm39) missense probably damaging 1.00
R6788:Trank1 UTSW 9 111,219,747 (GRCm39) missense probably damaging 1.00
R6831:Trank1 UTSW 9 111,206,967 (GRCm39) missense probably benign 0.00
R6934:Trank1 UTSW 9 111,202,158 (GRCm39) missense probably damaging 0.99
R7127:Trank1 UTSW 9 111,194,864 (GRCm39) missense possibly damaging 0.85
R7206:Trank1 UTSW 9 111,174,583 (GRCm39) critical splice donor site probably null
R7236:Trank1 UTSW 9 111,202,142 (GRCm39) missense possibly damaging 0.93
R7247:Trank1 UTSW 9 111,196,580 (GRCm39) missense probably damaging 1.00
R7292:Trank1 UTSW 9 111,206,938 (GRCm39) missense probably benign 0.02
R7310:Trank1 UTSW 9 111,196,194 (GRCm39) missense probably damaging 1.00
R7431:Trank1 UTSW 9 111,191,470 (GRCm39) missense probably benign 0.12
R7448:Trank1 UTSW 9 111,195,417 (GRCm39) missense probably benign 0.01
R7477:Trank1 UTSW 9 111,194,025 (GRCm39) missense probably benign 0.00
R7514:Trank1 UTSW 9 111,193,824 (GRCm39) missense probably damaging 1.00
R7595:Trank1 UTSW 9 111,195,059 (GRCm39) missense probably damaging 1.00
R7637:Trank1 UTSW 9 111,194,364 (GRCm39) missense possibly damaging 0.71
R7648:Trank1 UTSW 9 111,220,753 (GRCm39) missense probably benign
R7737:Trank1 UTSW 9 111,195,080 (GRCm39) nonsense probably null
R7784:Trank1 UTSW 9 111,193,171 (GRCm39) missense probably damaging 1.00
R7884:Trank1 UTSW 9 111,221,584 (GRCm39) missense probably benign
R7912:Trank1 UTSW 9 111,220,596 (GRCm39) missense probably benign 0.04
R7938:Trank1 UTSW 9 111,194,096 (GRCm39) missense probably benign
R7979:Trank1 UTSW 9 111,206,967 (GRCm39) missense probably benign 0.00
R8064:Trank1 UTSW 9 111,181,144 (GRCm39) nonsense probably null
R8100:Trank1 UTSW 9 111,221,861 (GRCm39) missense probably damaging 1.00
R8124:Trank1 UTSW 9 111,207,995 (GRCm39) missense probably benign 0.31
R8198:Trank1 UTSW 9 111,219,880 (GRCm39) missense probably benign 0.09
R8219:Trank1 UTSW 9 111,193,977 (GRCm39) missense probably damaging 1.00
R8223:Trank1 UTSW 9 111,194,957 (GRCm39) missense probably damaging 1.00
R8316:Trank1 UTSW 9 111,178,370 (GRCm39) missense probably benign 0.38
R8347:Trank1 UTSW 9 111,196,317 (GRCm39) missense probably damaging 1.00
R8436:Trank1 UTSW 9 111,220,450 (GRCm39) missense possibly damaging 0.86
R8489:Trank1 UTSW 9 111,219,343 (GRCm39) missense probably benign 0.01
R8768:Trank1 UTSW 9 111,218,344 (GRCm39) missense probably benign 0.00
R8770:Trank1 UTSW 9 111,219,892 (GRCm39) missense probably benign 0.00
R8829:Trank1 UTSW 9 111,176,591 (GRCm39) missense probably benign
R8838:Trank1 UTSW 9 111,193,973 (GRCm39) missense probably benign 0.03
R8855:Trank1 UTSW 9 111,141,289 (GRCm39) missense unknown
R8929:Trank1 UTSW 9 111,208,003 (GRCm39) missense possibly damaging 0.93
R9047:Trank1 UTSW 9 111,191,500 (GRCm39) missense probably damaging 0.99
R9090:Trank1 UTSW 9 111,174,547 (GRCm39) missense probably damaging 1.00
R9114:Trank1 UTSW 9 111,162,843 (GRCm39) missense probably damaging 1.00
R9133:Trank1 UTSW 9 111,220,770 (GRCm39) missense possibly damaging 0.93
R9177:Trank1 UTSW 9 111,221,579 (GRCm39) missense probably benign 0.00
R9178:Trank1 UTSW 9 111,196,268 (GRCm39) missense probably damaging 1.00
R9271:Trank1 UTSW 9 111,174,547 (GRCm39) missense probably damaging 1.00
R9314:Trank1 UTSW 9 111,195,049 (GRCm39) missense probably damaging 1.00
R9373:Trank1 UTSW 9 111,194,259 (GRCm39) missense probably benign 0.25
R9380:Trank1 UTSW 9 111,221,738 (GRCm39) missense probably benign 0.07
R9435:Trank1 UTSW 9 111,193,890 (GRCm39) missense probably benign 0.04
R9501:Trank1 UTSW 9 111,176,943 (GRCm39) missense probably benign 0.00
R9593:Trank1 UTSW 9 111,191,365 (GRCm39) missense probably benign 0.30
R9601:Trank1 UTSW 9 111,202,193 (GRCm39) missense probably benign 0.18
R9729:Trank1 UTSW 9 111,220,537 (GRCm39) missense probably damaging 1.00
X0064:Trank1 UTSW 9 111,172,304 (GRCm39) missense possibly damaging 0.57
Z1088:Trank1 UTSW 9 111,193,778 (GRCm39) missense probably damaging 0.99
Z1177:Trank1 UTSW 9 111,221,938 (GRCm39) missense possibly damaging 0.47
Z1177:Trank1 UTSW 9 111,196,445 (GRCm39) missense possibly damaging 0.83
Z1177:Trank1 UTSW 9 111,140,970 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TCAGGACACGTTCTTTGAGG -3'
(R):5'- ACCTTACTGGACAGCTTCTTCAG -3'

Sequencing Primer
(F):5'- ACACGTTCTTTGAGGGACCG -3'
(R):5'- TTCTGAAGTACACTCAATCTCCCAGG -3'
Posted On 2021-03-08