Incidental Mutation 'R8682:Wdr60'
ID 661830
Institutional Source Beutler Lab
Gene Symbol Wdr60
Ensembl Gene ENSMUSG00000042050
Gene Name WD repeat domain 60
Synonyms D430033N04Rik
MMRRC Submission 068537-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8682 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 116206262-116263022 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 116224990 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 661 (H661Q)
Ref Sequence ENSEMBL: ENSMUSP00000047334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039349]
AlphaFold Q8C761
Predicted Effect probably damaging
Transcript: ENSMUST00000039349
AA Change: H661Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047334
Gene: ENSMUSG00000042050
AA Change: H661Q

DomainStartEndE-ValueType
coiled coil region 84 122 N/A INTRINSIC
low complexity region 168 193 N/A INTRINSIC
low complexity region 226 242 N/A INTRINSIC
coiled coil region 280 309 N/A INTRINSIC
low complexity region 319 337 N/A INTRINSIC
low complexity region 439 453 N/A INTRINSIC
WD40 629 668 2.77e-1 SMART
Blast:WD40 694 755 2e-7 BLAST
WD40 846 881 3.84e0 SMART
WD40 884 926 5.55e-1 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD) and may facilitate the formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes including cell cycle progression, signal transduction, apoptosis, and gene regulation. The encoded protein contains four WD repeats and may play a role in the formation of cilia. Mutations in this gene have been associated with short-rib polydactyly and Jeune syndromes. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T A 11: 58,423,899 L141Q probably null Het
Abtb2 A T 2: 103,567,375 T217S probably benign Het
Adcy1 T C 11: 7,161,328 I873T probably damaging Het
Angpt4 A G 2: 151,927,085 M172V probably benign Het
Apaf1 A T 10: 90,995,670 V1194D probably damaging Het
Arhgap30 T C 1: 171,407,402 S479P probably benign Het
Asah2 C T 19: 32,052,877 V132M probably damaging Het
Bmp10 A G 6: 87,433,559 probably null Het
Bsn T C 9: 108,106,169 Y790C Het
Cacna2d1 C A 5: 16,353,839 R732S possibly damaging Het
Casr A T 16: 36,495,422 F762Y possibly damaging Het
Cbln1 T C 8: 87,472,107 D45G possibly damaging Het
Cd177 A T 7: 24,760,013 M61K possibly damaging Het
Cdh11 T C 8: 102,650,716 I433V probably benign Het
Cdhr5 A G 7: 141,275,986 probably null Het
Col12a1 T A 9: 79,661,076 K1622I probably benign Het
Cyp2d9 A G 15: 82,453,716 D103G probably damaging Het
Fem1b A T 9: 62,797,150 L276* probably null Het
Fggy T A 4: 95,812,121 V343E probably damaging Het
Flt3 A G 5: 147,383,455 V33A probably benign Het
Gm6904 G A 14: 59,258,584 T27I probably benign Het
Gm8994 A G 6: 136,329,029 T163A possibly damaging Het
Grn T C 11: 102,434,820 Y288H probably benign Het
Grtp1 G A 8: 13,179,499 R272W probably damaging Het
H2-Aa A G 17: 34,283,760 I144T possibly damaging Het
Herc1 A G 9: 66,462,848 D469G Het
Hsf2 G A 10: 57,505,171 E286K possibly damaging Het
Hydin A G 8: 110,309,166 E163G probably damaging Het
Il6ra A G 3: 89,886,669 I224T possibly damaging Het
Itih3 T A 14: 30,920,716 I204F possibly damaging Het
Kcnj9 A T 1: 172,326,113 M148K possibly damaging Het
Lepr T G 4: 101,792,072 V890G probably benign Het
Mslnl A G 17: 25,746,988 D612G probably benign Het
Myl2 T A 5: 122,106,735 V156D probably damaging Het
Neb C A 2: 52,246,845 W3208L probably damaging Het
Neto2 T C 8: 85,640,666 Y511C probably benign Het
Obox2 C A 7: 15,396,987 T48K possibly damaging Het
Olfr1109 A T 2: 87,093,046 M117K possibly damaging Het
Olfr305 C T 7: 86,364,165 M57I probably damaging Het
Olfr568 T A 7: 102,877,439 F106L probably benign Het
Osbpl6 C G 2: 76,577,081 H486D probably benign Het
Pfkfb3 T C 2: 11,484,333 K264E probably benign Het
Pla2r1 T A 2: 60,422,776 T1324S possibly damaging Het
Plekhg1 A T 10: 3,947,523 Y495F Het
Ppp2r5d T C 17: 46,687,063 K225E probably benign Het
Ptpn11 T C 5: 121,167,990 D64G possibly damaging Het
Ptprs A G 17: 56,435,849 I431T probably damaging Het
Rapgef5 T C 12: 117,581,812 S100P probably benign Het
Rnf219 G T 14: 104,480,233 R235S probably damaging Het
Shh T A 5: 28,458,060 H370L probably benign Het
Siah3 A T 14: 75,525,603 H98L possibly damaging Het
Sim2 C T 16: 94,123,333 H446Y probably benign Het
Skint4 T C 4: 112,136,040 I320T possibly damaging Het
Sorcs1 A T 19: 50,378,960 N221K probably damaging Het
Sox6 T C 7: 115,476,956 S816G probably damaging Het
Sphkap T C 1: 83,279,276 T251A probably benign Het
Stard9 T C 2: 120,703,315 V3351A possibly damaging Het
Tbc1d15 A G 10: 115,210,290 V436A probably benign Het
Thsd7b A T 1: 129,760,274 K641* probably null Het
Tmc5 G T 7: 118,670,702 V892F possibly damaging Het
Tpsab1 T A 17: 25,343,711 H238L probably benign Het
Trank1 A G 9: 111,365,344 N812S probably benign Het
Trio T A 15: 27,905,192 N163Y unknown Het
Ttc39d A G 17: 80,217,264 T451A probably benign Het
Ube3b T C 5: 114,412,290 L832P probably damaging Het
Vmn2r15 C A 5: 109,294,072 C165F probably damaging Het
Vmn2r90 T C 17: 17,712,082 F84L possibly damaging Het
Wdr95 C T 5: 149,595,287 T531I possibly damaging Het
Zcrb1 C A 15: 93,386,237 G191V probably benign Het
Zfp111 G A 7: 24,198,558 P544S probably damaging Het
Zfyve9 T C 4: 108,719,342 S181G probably benign Het
Other mutations in Wdr60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Wdr60 APN 12 116241780 missense probably benign 0.01
IGL00668:Wdr60 APN 12 116257428 missense probably benign 0.32
IGL00914:Wdr60 APN 12 116232603 missense probably damaging 1.00
IGL01061:Wdr60 APN 12 116229704 missense probably benign 0.45
IGL01375:Wdr60 APN 12 116229676 missense possibly damaging 0.91
IGL01758:Wdr60 APN 12 116218798 missense possibly damaging 0.82
IGL01930:Wdr60 APN 12 116225963 critical splice donor site probably null
IGL02028:Wdr60 APN 12 116256061 missense probably benign 0.06
IGL03180:Wdr60 APN 12 116218865 missense probably benign 0.07
F5770:Wdr60 UTSW 12 116211840 missense possibly damaging 0.73
R0153:Wdr60 UTSW 12 116232636 missense probably benign 0.01
R0265:Wdr60 UTSW 12 116257406 splice site probably benign
R0364:Wdr60 UTSW 12 116257477 splice site probably benign
R0601:Wdr60 UTSW 12 116255935 missense possibly damaging 0.79
R0624:Wdr60 UTSW 12 116248290 missense probably damaging 0.98
R0755:Wdr60 UTSW 12 116211792 missense probably benign 0.01
R1023:Wdr60 UTSW 12 116232657 missense probably damaging 1.00
R1065:Wdr60 UTSW 12 116256076 missense probably damaging 0.98
R1543:Wdr60 UTSW 12 116231784 splice site probably benign
R1663:Wdr60 UTSW 12 116229610 missense probably benign 0.01
R1678:Wdr60 UTSW 12 116225970 missense probably damaging 1.00
R1719:Wdr60 UTSW 12 116255912 missense probably benign
R1755:Wdr60 UTSW 12 116226029 missense probably damaging 0.98
R1832:Wdr60 UTSW 12 116207743 missense probably damaging 0.99
R1918:Wdr60 UTSW 12 116232601 missense probably damaging 0.96
R2291:Wdr60 UTSW 12 116229571 splice site probably null
R2444:Wdr60 UTSW 12 116232669 missense possibly damaging 0.93
R3419:Wdr60 UTSW 12 116224977 missense probably benign 0.05
R3699:Wdr60 UTSW 12 116211842 nonsense probably null
R3700:Wdr60 UTSW 12 116211842 nonsense probably null
R4445:Wdr60 UTSW 12 116207715 missense probably damaging 1.00
R4664:Wdr60 UTSW 12 116256211 missense probably damaging 0.99
R4954:Wdr60 UTSW 12 116256025 missense probably damaging 1.00
R5057:Wdr60 UTSW 12 116213413 missense probably benign 0.43
R5163:Wdr60 UTSW 12 116255866 missense possibly damaging 0.76
R5341:Wdr60 UTSW 12 116255914 missense possibly damaging 0.51
R5560:Wdr60 UTSW 12 116218113 missense probably damaging 0.98
R5870:Wdr60 UTSW 12 116256245 missense possibly damaging 0.94
R5925:Wdr60 UTSW 12 116233394 missense possibly damaging 0.82
R6223:Wdr60 UTSW 12 116257458 missense possibly damaging 0.95
R6364:Wdr60 UTSW 12 116241732 missense probably damaging 1.00
R6450:Wdr60 UTSW 12 116246727 nonsense probably null
R6462:Wdr60 UTSW 12 116229631 missense probably benign
R6751:Wdr60 UTSW 12 116213456 missense possibly damaging 0.52
R6896:Wdr60 UTSW 12 116229671 missense possibly damaging 0.52
R6962:Wdr60 UTSW 12 116211778 missense probably damaging 1.00
R7033:Wdr60 UTSW 12 116211891 missense probably benign 0.03
R7042:Wdr60 UTSW 12 116254441 missense probably benign 0.02
R7254:Wdr60 UTSW 12 116262585 intron probably benign
R7567:Wdr60 UTSW 12 116254510 splice site probably null
R7889:Wdr60 UTSW 12 116255939 nonsense probably null
R8082:Wdr60 UTSW 12 116213507 critical splice acceptor site probably null
R8288:Wdr60 UTSW 12 116213725 missense probably damaging 1.00
R8309:Wdr60 UTSW 12 116256085 missense probably damaging 1.00
R8683:Wdr60 UTSW 12 116229642 missense probably benign 0.03
R8699:Wdr60 UTSW 12 116207701 missense probably benign 0.01
R8782:Wdr60 UTSW 12 116241712 missense probably damaging 1.00
R8809:Wdr60 UTSW 12 116229614 missense probably damaging 0.98
R9281:Wdr60 UTSW 12 116248057 nonsense probably null
R9530:Wdr60 UTSW 12 116211791 missense possibly damaging 0.87
R9751:Wdr60 UTSW 12 116241783 critical splice acceptor site probably null
V7581:Wdr60 UTSW 12 116211840 missense possibly damaging 0.73
V7582:Wdr60 UTSW 12 116211840 missense possibly damaging 0.73
V7583:Wdr60 UTSW 12 116211840 missense possibly damaging 0.73
X0063:Wdr60 UTSW 12 116255869 missense probably benign
Z1177:Wdr60 UTSW 12 116246099 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGAGTCTGATCTCTTCCTCTGG -3'
(R):5'- AAACTCACACTTGGGCAGTTG -3'

Sequencing Primer
(F):5'- ATCTCTTCCTCTGGATAATCTGAATG -3'
(R):5'- TGTGTTCTACTTAATTGTATCCTGTG -3'
Posted On 2021-03-08