Incidental Mutation 'R8682:Mslnl'
ID661843
Institutional Source Beutler Lab
Gene Symbol Mslnl
Ensembl Gene ENSMUSG00000041062
Gene Namemesothelin-like
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8682 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location25736040-25748330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25746988 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 612 (D612G)
Ref Sequence ENSEMBL: ENSMUSP00000049020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047098] [ENSMUST00000075884]
Predicted Effect probably benign
Transcript: ENSMUST00000047098
AA Change: D612G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000049020
Gene: ENSMUSG00000041062
AA Change: D612G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Mesothelin 29 589 2.8e-70 PFAM
low complexity region 633 653 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075884
SMART Domains Protein: ENSMUSP00000075279
Gene: ENSMUSG00000063011

DomainStartEndE-ValueType
Pfam:Mesothelin 1 624 N/A PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T A 11: 58,423,899 L141Q probably null Het
Abtb2 A T 2: 103,567,375 T217S probably benign Het
Adcy1 T C 11: 7,161,328 I873T probably damaging Het
Angpt4 A G 2: 151,927,085 M172V probably benign Het
Apaf1 A T 10: 90,995,670 V1194D probably damaging Het
Arhgap30 T C 1: 171,407,402 S479P probably benign Het
Asah2 C T 19: 32,052,877 V132M probably damaging Het
Bmp10 A G 6: 87,433,559 probably null Het
Bsn T C 9: 108,106,169 Y790C Het
Cacna2d1 C A 5: 16,353,839 R732S possibly damaging Het
Casr A T 16: 36,495,422 F762Y possibly damaging Het
Cbln1 T C 8: 87,472,107 D45G possibly damaging Het
Cd177 A T 7: 24,760,013 M61K possibly damaging Het
Cdh11 T C 8: 102,650,716 I433V probably benign Het
Cdhr5 A G 7: 141,275,986 probably null Het
Col12a1 T A 9: 79,661,076 K1622I probably benign Het
Cyp2d9 A G 15: 82,453,716 D103G probably damaging Het
Fem1b A T 9: 62,797,150 L276* probably null Het
Fggy T A 4: 95,812,121 V343E probably damaging Het
Flt3 A G 5: 147,383,455 V33A probably benign Het
Gm6904 G A 14: 59,258,584 T27I probably benign Het
Gm8994 A G 6: 136,329,029 T163A possibly damaging Het
Grn T C 11: 102,434,820 Y288H probably benign Het
Grtp1 G A 8: 13,179,499 R272W probably damaging Het
H2-Aa A G 17: 34,283,760 I144T possibly damaging Het
Herc1 A G 9: 66,462,848 D469G Het
Hsf2 G A 10: 57,505,171 E286K possibly damaging Het
Hydin A G 8: 110,309,166 E163G probably damaging Het
Il6ra A G 3: 89,886,669 I224T possibly damaging Het
Itih3 T A 14: 30,920,716 I204F possibly damaging Het
Kcnj9 A T 1: 172,326,113 M148K possibly damaging Het
Lepr T G 4: 101,792,072 V890G probably benign Het
Myl2 T A 5: 122,106,735 V156D probably damaging Het
Neb C A 2: 52,246,845 W3208L probably damaging Het
Neto2 T C 8: 85,640,666 Y511C probably benign Het
Obox2 C A 7: 15,396,987 T48K possibly damaging Het
Olfr1109 A T 2: 87,093,046 M117K possibly damaging Het
Olfr305 C T 7: 86,364,165 M57I probably damaging Het
Olfr568 T A 7: 102,877,439 F106L probably benign Het
Osbpl6 C G 2: 76,577,081 H486D probably benign Het
Pfkfb3 T C 2: 11,484,333 K264E probably benign Het
Pla2r1 T A 2: 60,422,776 T1324S possibly damaging Het
Plekhg1 A T 10: 3,947,523 Y495F Het
Ppp2r5d T C 17: 46,687,063 K225E probably benign Het
Ptpn11 T C 5: 121,167,990 D64G possibly damaging Het
Ptprs A G 17: 56,435,849 I431T probably damaging Het
Rapgef5 T C 12: 117,581,812 S100P probably benign Het
Rnf219 G T 14: 104,480,233 R235S probably damaging Het
Shh T A 5: 28,458,060 H370L probably benign Het
Siah3 A T 14: 75,525,603 H98L possibly damaging Het
Sim2 C T 16: 94,123,333 H446Y probably benign Het
Skint4 T C 4: 112,136,040 I320T possibly damaging Het
Sorcs1 A T 19: 50,378,960 N221K probably damaging Het
Sox6 T C 7: 115,476,956 S816G probably damaging Het
Sphkap T C 1: 83,279,276 T251A probably benign Het
Stard9 T C 2: 120,703,315 V3351A possibly damaging Het
Tbc1d15 A G 10: 115,210,290 V436A probably benign Het
Thsd7b A T 1: 129,760,274 K641* probably null Het
Tmc5 G T 7: 118,670,702 V892F possibly damaging Het
Tpsab1 T A 17: 25,343,711 H238L probably benign Het
Trank1 A G 9: 111,365,344 N812S probably benign Het
Trio T A 15: 27,905,192 N163Y unknown Het
Ttc39d A G 17: 80,217,264 T451A probably benign Het
Ube3b T C 5: 114,412,290 L832P probably damaging Het
Vmn2r15 C A 5: 109,294,072 C165F probably damaging Het
Vmn2r90 T C 17: 17,712,082 F84L possibly damaging Het
Wdr60 A T 12: 116,224,990 H661Q probably damaging Het
Wdr95 C T 5: 149,595,287 T531I possibly damaging Het
Zcrb1 C A 15: 93,386,237 G191V probably benign Het
Zfp111 G A 7: 24,198,558 P544S probably damaging Het
Zfyve9 T C 4: 108,719,342 S181G probably benign Het
Other mutations in Mslnl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Mslnl APN 17 25743667 unclassified probably benign
IGL01629:Mslnl APN 17 25744775 missense possibly damaging 0.95
IGL02084:Mslnl APN 17 25746151 missense probably benign 0.07
IGL02408:Mslnl APN 17 25747998 missense possibly damaging 0.80
IGL02726:Mslnl APN 17 25744103 critical splice donor site probably null
IGL03387:Mslnl APN 17 25744077 missense probably benign 0.06
R0561:Mslnl UTSW 17 25743203 nonsense probably null
R0881:Mslnl UTSW 17 25742965 missense possibly damaging 0.82
R1295:Mslnl UTSW 17 25743240 missense probably damaging 1.00
R1296:Mslnl UTSW 17 25743240 missense probably damaging 1.00
R1582:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1629:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1630:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1631:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1632:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1794:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1850:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1866:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1876:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1914:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2166:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2241:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2243:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2247:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2282:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2284:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2852:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2867:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2867:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2877:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2878:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2919:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2920:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3026:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3405:Mslnl UTSW 17 25746181 missense probably damaging 1.00
R3406:Mslnl UTSW 17 25746181 missense probably damaging 1.00
R3411:Mslnl UTSW 17 25744517 missense probably benign 0.05
R3434:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3546:Mslnl UTSW 17 25744969 missense probably damaging 0.98
R3612:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3729:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3730:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3802:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3804:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3894:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3895:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4454:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4455:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4456:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4457:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4561:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4562:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4564:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4600:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4601:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4610:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4704:Mslnl UTSW 17 25738978 missense possibly damaging 0.73
R5155:Mslnl UTSW 17 25738968 nonsense probably null
R5257:Mslnl UTSW 17 25746165 missense probably benign 0.00
R5456:Mslnl UTSW 17 25743159 missense probably damaging 0.98
R5645:Mslnl UTSW 17 25737842 missense possibly damaging 0.95
R6007:Mslnl UTSW 17 25746775 missense probably benign 0.00
R6083:Mslnl UTSW 17 25737902 missense possibly damaging 0.83
R6142:Mslnl UTSW 17 25744557 missense probably damaging 1.00
R6761:Mslnl UTSW 17 25746073 missense probably damaging 1.00
R7058:Mslnl UTSW 17 25743212 missense probably benign 0.03
R7156:Mslnl UTSW 17 25743210 missense probably benign 0.20
R7467:Mslnl UTSW 17 25736921 start codon destroyed probably benign 0.33
R7687:Mslnl UTSW 17 25743183 missense probably damaging 0.97
R7807:Mslnl UTSW 17 25746777 missense probably benign 0.03
R8735:Mslnl UTSW 17 25745088 missense probably benign 0.09
R8742:Mslnl UTSW 17 25745073 missense probably damaging 1.00
RF007:Mslnl UTSW 17 25743228 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CTTCATTTGCAGAGCATGGGAG -3'
(R):5'- AGGAAATTGTTTCACCATAGATGG -3'

Sequencing Primer
(F):5'- AATCTGCTGGGCCAGAAC -3'
(R):5'- CCATAGATGGTTCATTAGGCAATGAC -3'
Posted On2021-03-08