Incidental Mutation 'R8683:Copg1'
ID 661873
Institutional Source Beutler Lab
Gene Symbol Copg1
Ensembl Gene ENSMUSG00000030058
Gene Name coatomer protein complex, subunit gamma 1
Synonyms D6Ertd71e, Copg, D6Wsu16e
MMRRC Submission
Accession Numbers

Genbank: NM_017477, NM_201244; MGI: 1858696

Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock # R8683 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 87887814-87913595 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 87892655 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 172 (D172G)
Ref Sequence ENSEMBL: ENSMUSP00000109237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049966] [ENSMUST00000113607]
AlphaFold Q9QZE5
Predicted Effect probably benign
Transcript: ENSMUST00000049966
SMART Domains Protein: ENSMUSP00000050858
Gene: ENSMUSG00000030058

DomainStartEndE-ValueType
Pfam:Adaptin_N 23 109 2e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113607
AA Change: D172G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109237
Gene: ENSMUSG00000030058
AA Change: D172G

DomainStartEndE-ValueType
Pfam:Adaptin_N 23 539 4.1e-135 PFAM
Pfam:COP-gamma_platf 611 759 7.6e-64 PFAM
Pfam:Coatomer_g_Cpla 761 873 1.5e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI

All alleles(58) : Targeted, other(2) Gene trapped(56)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars A G 8: 111,042,249 D227G possibly damaging Het
Actl11 T A 9: 107,928,866 D129E probably benign Het
Adam12 T A 7: 133,890,200 E877D possibly damaging Het
Adarb2 T A 13: 8,757,359 V732E probably damaging Het
Adcy1 T C 11: 7,161,328 I873T probably damaging Het
Adgrg1 C T 8: 95,009,648 H477Y probably damaging Het
Ahctf1 T C 1: 179,795,756 E99G possibly damaging Het
AI314180 T C 4: 58,834,515 S788G probably benign Het
Ankk1 T A 9: 49,417,992 M93L Het
Ankmy1 A T 1: 92,885,250 L446M possibly damaging Het
Anxa10 T A 8: 62,057,791 Y309F probably damaging Het
Arg2 C T 12: 79,150,020 Q172* probably null Het
Atp6v0a4 T A 6: 38,048,991 *834L probably null Het
Avl9 T A 6: 56,753,393 S574T probably benign Het
AW551984 G A 9: 39,599,709 T194I possibly damaging Het
Azin1 G A 15: 38,493,531 L283F probably damaging Het
BC051142 A T 17: 34,448,808 Q158L possibly damaging Het
Birc6 G A 17: 74,609,119 A1677T possibly damaging Het
Carm1 A T 9: 21,586,168 D342V possibly damaging Het
Ccr4 T C 9: 114,492,148 D283G probably damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cntn2 A T 1: 132,522,993 L548Q probably damaging Het
Cyp2j12 T A 4: 96,121,568 N185Y probably benign Het
Dapk3 T C 10: 81,190,235 L120P probably damaging Het
Dclre1b A C 3: 103,803,982 S204R probably damaging Het
Dennd2a G A 6: 39,523,203 R143* probably null Het
Dnah5 A T 15: 28,289,221 E1185D probably benign Het
Dopey2 C T 16: 93,771,811 T1587I probably damaging Het
Dopey2 A G 16: 93,773,921 T1603A probably benign Het
Dym T A 18: 75,230,018 V531E probably damaging Het
Eif2b4 A T 5: 31,187,930 F453L probably damaging Het
Entpd8 G A 2: 25,084,980 G441D probably damaging Het
Fam71d TGATGTCACAGATGTCAC TGATGTCAC 12: 78,715,283 probably benign Het
Galnt6 A T 15: 100,694,722 Y535N probably damaging Het
Gm10340 T A 14: 3,134,949 D72E possibly damaging Het
Gm13102 T A 4: 144,109,110 D449E probably damaging Het
Hdac9 T A 12: 34,390,221 K386N probably damaging Het
Hgs T A 11: 120,475,218 C212* probably null Het
Hoxa2 C A 6: 52,164,560 A29S possibly damaging Het
Ifnar1 T A 16: 91,499,444 W278R probably damaging Het
Irf7 C T 7: 141,263,509 G389R probably null Het
Lipo1 G A 19: 33,782,204 L211F probably benign Het
Mars2 C T 1: 55,238,582 T448I probably benign Het
Mcm4 C A 16: 15,635,274 G184C probably damaging Het
Mmaa C T 8: 79,267,969 A403T probably damaging Het
Mmel1 A G 4: 154,889,528 I342V probably benign Het
Myb T C 10: 21,150,506 T188A possibly damaging Het
Myo1g C T 11: 6,517,569 probably null Het
Npas2 A G 1: 39,347,627 Q659R probably benign Het
Npr1 A G 3: 90,455,190 V941A probably benign Het
Numa1 T G 7: 101,977,410 M1R probably null Het
Obscn T C 11: 59,076,879 S2700G probably benign Het
Olfr1002 A T 2: 85,648,066 I85N probably benign Het
Olfr721-ps1 T A 14: 14,407,480 L84H probably benign Het
Olfr730 A T 14: 50,186,746 M157K possibly damaging Het
Pdpr T A 8: 111,123,860 H476Q probably damaging Het
Pkd1l1 A T 11: 8,871,805 S1630T Het
Prdm16 A G 4: 154,528,704 S89P probably damaging Het
Ptgdr2 T A 19: 10,940,529 W137R possibly damaging Het
Ptpra A G 2: 130,552,267 I784V possibly damaging Het
Rabepk G T 2: 34,795,176 D77E possibly damaging Het
Sh2b1 GGGGACCAGCTCAGCCACGGGGACCAGCTC GGGGACCAGCTCAGCCACAGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,571 probably benign Het
Smc3 T A 19: 53,641,185 S994T possibly damaging Het
Sparc A G 11: 55,401,957 C147R probably damaging Het
Supt6 A T 11: 78,217,901 D1191E probably benign Het
Susd4 T C 1: 182,892,267 probably null Het
Tbc1d5 A G 17: 50,984,603 probably null Het
Tecta T G 9: 42,366,972 D1080A probably damaging Het
Tenm4 G T 7: 96,902,857 W2538L probably damaging Het
Trappc9 A G 15: 73,012,815 F439L probably benign Het
Vegfa A T 17: 46,031,470 S141T probably benign Het
Vmn2r9 T A 5: 108,849,007 D132V probably benign Het
Wdr60 G T 12: 116,229,642 D563E probably benign Het
Other mutations in Copg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Copg1 APN 6 87902370 missense possibly damaging 0.94
IGL00816:Copg1 APN 6 87893898 missense possibly damaging 0.95
IGL02087:Copg1 APN 6 87902210 missense possibly damaging 0.68
R0194:Copg1 UTSW 6 87904197 splice site probably benign
R0448:Copg1 UTSW 6 87904926 missense probably benign
R0576:Copg1 UTSW 6 87897963 missense probably damaging 1.00
R0701:Copg1 UTSW 6 87894107 nonsense probably null
R1251:Copg1 UTSW 6 87890007 nonsense probably null
R1707:Copg1 UTSW 6 87905210 missense probably benign
R1845:Copg1 UTSW 6 87893818 missense probably damaging 1.00
R3500:Copg1 UTSW 6 87895923 splice site probably benign
R3952:Copg1 UTSW 6 87905216 missense probably benign
R4283:Copg1 UTSW 6 87908545 missense probably damaging 1.00
R4515:Copg1 UTSW 6 87907546 intron probably benign
R4715:Copg1 UTSW 6 87912286 nonsense probably null
R4797:Copg1 UTSW 6 87903468 intron probably benign
R4864:Copg1 UTSW 6 87889696 missense probably damaging 1.00
R4947:Copg1 UTSW 6 87903473 splice site probably benign
R5265:Copg1 UTSW 6 87892270 missense probably damaging 0.98
R5288:Copg1 UTSW 6 87890207 missense possibly damaging 0.90
R5386:Copg1 UTSW 6 87890207 missense possibly damaging 0.90
R5511:Copg1 UTSW 6 87912294 missense probably damaging 0.99
R5670:Copg1 UTSW 6 87912235 missense probably damaging 1.00
R5887:Copg1 UTSW 6 87902297 missense probably damaging 1.00
R7014:Copg1 UTSW 6 87902340 missense probably damaging 1.00
R7021:Copg1 UTSW 6 87894105 missense possibly damaging 0.94
R7380:Copg1 UTSW 6 87893842 missense probably damaging 0.98
R7392:Copg1 UTSW 6 87890275 missense probably benign 0.01
R7629:Copg1 UTSW 6 87894169 missense possibly damaging 0.90
R7704:Copg1 UTSW 6 87907958 missense probably benign 0.13
R8060:Copg1 UTSW 6 87909721 missense probably damaging 0.96
R8184:Copg1 UTSW 6 87890014 missense probably damaging 1.00
R9320:Copg1 UTSW 6 87910090 missense possibly damaging 0.65
R9433:Copg1 UTSW 6 87903496 missense possibly damaging 0.95
R9564:Copg1 UTSW 6 87892701 missense probably damaging 0.97
R9660:Copg1 UTSW 6 87902243 missense probably damaging 0.96
R9709:Copg1 UTSW 6 87891975 missense probably benign 0.22
R9728:Copg1 UTSW 6 87902243 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGTGAGGGTTGACAGCTGTC -3'
(R):5'- TCTATCAGCAGCATCCAGTGAG -3'

Sequencing Primer
(F):5'- AGCTGTCTGTCTGTCCATTCATG -3'
(R):5'- GCAGCATCCAGTGAGAAATCCTTC -3'
Posted On 2021-03-08