Incidental Mutation 'R8683:Sparc'
ID661896
Institutional Source Beutler Lab
Gene Symbol Sparc
Ensembl Gene ENSMUSG00000018593
Gene Namesecreted acidic cysteine rich glycoprotein
SynonymsBM-40, osteonectin
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8683 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location55394500-55423183 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55401957 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 147 (C147R)
Ref Sequence ENSEMBL: ENSMUSP00000104486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018737] [ENSMUST00000108858] [ENSMUST00000141530] [ENSMUST00000213866] [ENSMUST00000214685] [ENSMUST00000216313]
Predicted Effect probably damaging
Transcript: ENSMUST00000018737
AA Change: C148R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018737
Gene: ENSMUSG00000018593
AA Change: C148R

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 22 42 N/A INTRINSIC
FOLN 70 93 5.24e-8 SMART
KAZAL 93 148 1.16e-9 SMART
Pfam:SPARC_Ca_bdg 151 288 5.3e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108858
AA Change: C147R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104486
Gene: ENSMUSG00000018593
AA Change: C147R

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 21 41 N/A INTRINSIC
FOLN 69 92 5.24e-8 SMART
KAZAL 92 147 1.16e-9 SMART
Pfam:SPARC_Ca_bdg 150 287 1.1e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000141530
AA Change: C146R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119475
Gene: ENSMUSG00000018593
AA Change: C146R

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
FOLN 68 91 5.24e-8 SMART
KAZAL 91 146 1.16e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000213866
AA Change: C178R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214685
AA Change: C148R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216313
AA Change: C178R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cysteine-rich acidic matrix-associated protein. The encoded protein is required for the collagen in bone to become calcified but is also involved in extracellular matrix synthesis and promotion of changes to cell shape. The gene product has been associated with tumor suppression but has also been correlated with metastasis based on changes to cell shape which can promote tumor cell invasion. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit cataracts, reduced skin collagen content, accelerated wound closure, osteopenia associated with reduced bone remodeling, and increased growth of implanted tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars A G 8: 111,042,249 D227G possibly damaging Het
Actl11 T A 9: 107,928,866 D129E probably benign Het
Adam12 T A 7: 133,890,200 E877D possibly damaging Het
Adarb2 T A 13: 8,757,359 V732E probably damaging Het
Adcy1 T C 11: 7,161,328 I873T probably damaging Het
Adgrg1 C T 8: 95,009,648 H477Y probably damaging Het
Ahctf1 T C 1: 179,795,756 E99G possibly damaging Het
AI314180 T C 4: 58,834,515 S788G probably benign Het
Ankk1 T A 9: 49,417,992 M93L Het
Ankmy1 A T 1: 92,885,250 L446M possibly damaging Het
Anxa10 T A 8: 62,057,791 Y309F probably damaging Het
Arg2 C T 12: 79,150,020 Q172* probably null Het
Atp6v0a4 T A 6: 38,048,991 *834L probably null Het
Avl9 T A 6: 56,753,393 S574T probably benign Het
AW551984 G A 9: 39,599,709 T194I possibly damaging Het
Azin1 G A 15: 38,493,531 L283F probably damaging Het
BC051142 A T 17: 34,448,808 Q158L possibly damaging Het
Birc6 G A 17: 74,609,119 A1677T possibly damaging Het
Carm1 A T 9: 21,586,168 D342V possibly damaging Het
Ccr4 T C 9: 114,492,148 D283G probably damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cntn2 A T 1: 132,522,993 L548Q probably damaging Het
Copg1 A G 6: 87,892,655 D172G probably damaging Het
Cyp2j12 T A 4: 96,121,568 N185Y probably benign Het
Dapk3 T C 10: 81,190,235 L120P probably damaging Het
Dclre1b A C 3: 103,803,982 S204R probably damaging Het
Dennd2a G A 6: 39,523,203 R143* probably null Het
Dnah5 A T 15: 28,289,221 E1185D probably benign Het
Dopey2 C T 16: 93,771,811 T1587I probably damaging Het
Dopey2 A G 16: 93,773,921 T1603A probably benign Het
Dym T A 18: 75,230,018 V531E probably damaging Het
Eif2b4 A T 5: 31,187,930 F453L probably damaging Het
Entpd8 G A 2: 25,084,980 G441D probably damaging Het
Fam71d TGATGTCACAGATGTCAC TGATGTCAC 12: 78,715,283 probably benign Het
Galnt6 A T 15: 100,694,722 Y535N probably damaging Het
Gm10340 T A 14: 3,134,949 D72E possibly damaging Het
Gm13102 T A 4: 144,109,110 D449E probably damaging Het
Hdac9 T A 12: 34,390,221 K386N probably damaging Het
Hgs T A 11: 120,475,218 C212* probably null Het
Hoxa2 C A 6: 52,164,560 A29S possibly damaging Het
Ifnar1 T A 16: 91,499,444 W278R probably damaging Het
Irf7 C T 7: 141,263,509 G389R probably null Het
Lipo1 G A 19: 33,782,204 L211F probably benign Het
Mars2 C T 1: 55,238,582 T448I probably benign Het
Mcm4 C A 16: 15,635,274 G184C probably damaging Het
Mmaa C T 8: 79,267,969 A403T probably damaging Het
Mmel1 A G 4: 154,889,528 I342V probably benign Het
Myb T C 10: 21,150,506 T188A possibly damaging Het
Myo1g C T 11: 6,517,569 probably null Het
Npas2 A G 1: 39,347,627 Q659R probably benign Het
Npr1 A G 3: 90,455,190 V941A probably benign Het
Numa1 T G 7: 101,977,410 M1R probably null Het
Obscn T C 11: 59,076,879 S2700G probably benign Het
Olfr1002 A T 2: 85,648,066 I85N probably benign Het
Olfr721-ps1 T A 14: 14,407,480 L84H probably benign Het
Olfr730 A T 14: 50,186,746 M157K possibly damaging Het
Pdpr T A 8: 111,123,860 H476Q probably damaging Het
Pkd1l1 A T 11: 8,871,805 S1630T Het
Prdm16 A G 4: 154,528,704 S89P probably damaging Het
Ptgdr2 T A 19: 10,940,529 W137R possibly damaging Het
Ptpra A G 2: 130,552,267 I784V possibly damaging Het
Rabepk G T 2: 34,795,176 D77E possibly damaging Het
Sh2b1 GGGGACCAGCTCAGCCACGGGGACCAGCTC GGGGACCAGCTCAGCCACAGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,571 probably benign Het
Smc3 T A 19: 53,641,185 S994T possibly damaging Het
Supt6 A T 11: 78,217,901 D1191E probably benign Het
Susd4 T C 1: 182,892,267 probably null Het
Tbc1d5 A G 17: 50,984,603 probably null Het
Tecta T G 9: 42,366,972 D1080A probably damaging Het
Tenm4 G T 7: 96,902,857 W2538L probably damaging Het
Trappc9 A G 15: 73,012,815 F439L probably benign Het
Vegfa A T 17: 46,031,470 S141T probably benign Het
Vmn2r9 T A 5: 108,849,007 D132V probably benign Het
Wdr60 G T 12: 116,229,642 D563E probably benign Het
Other mutations in Sparc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01768:Sparc APN 11 55405243 missense probably damaging 0.99
IGL01790:Sparc APN 11 55407215 splice site probably null
R1711:Sparc UTSW 11 55395776 splice site probably null
R1840:Sparc UTSW 11 55395866 missense probably damaging 1.00
R1859:Sparc UTSW 11 55406508 critical splice donor site probably null
R2172:Sparc UTSW 11 55395801 nonsense probably null
R4588:Sparc UTSW 11 55405236 missense probably benign 0.00
R4860:Sparc UTSW 11 55399211 missense possibly damaging 0.92
R4860:Sparc UTSW 11 55399211 missense possibly damaging 0.92
R7748:Sparc UTSW 11 55398600 missense probably benign 0.01
R7803:Sparc UTSW 11 55409971 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGTAGGCTCTTGCAATCTTCTC -3'
(R):5'- GTCCCCACATCTGAAATGGC -3'

Sequencing Primer
(F):5'- ATGTGCTTCCATGATGGCTAAGAC -3'
(R):5'- CAATGACAGGGATCCCAGGTC -3'
Posted On2021-03-08