Incidental Mutation 'R8683:Adarb2'
ID661904
Institutional Source Beutler Lab
Gene Symbol Adarb2
Ensembl Gene ENSMUSG00000052551
Gene Nameadenosine deaminase, RNA-specific, B2
SynonymsAdar3, RED2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8683 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location8202866-8768747 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 8757359 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 732 (V732E)
Ref Sequence ENSEMBL: ENSMUSP00000064775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064473] [ENSMUST00000123187] [ENSMUST00000135574]
Predicted Effect probably damaging
Transcript: ENSMUST00000064473
AA Change: V732E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064775
Gene: ENSMUSG00000052551
AA Change: V732E

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 21 33 N/A INTRINSIC
DSRM 126 190 1.03e-16 SMART
DSRM 284 346 1.24e-15 SMART
ADEAMc 366 742 5.41e-211 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123187
SMART Domains Protein: ENSMUSP00000120757
Gene: ENSMUSG00000052551

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 21 33 N/A INTRINSIC
DSRM 126 190 6.1e-19 SMART
DSRM 284 346 7.3e-18 SMART
ADEAMc 366 698 2e-164 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000135574
AA Change: V732E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115148
Gene: ENSMUSG00000052551
AA Change: V732E

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 21 33 N/A INTRINSIC
DSRM 126 190 1.03e-16 SMART
DSRM 284 346 1.24e-15 SMART
ADEAMc 366 742 5.41e-211 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the double-stranded RNA adenosine deaminase family of RNA-editing enzymes and may play a regulatory role in RNA editing. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars A G 8: 111,042,249 D227G possibly damaging Het
Actl11 T A 9: 107,928,866 D129E probably benign Het
Adam12 T A 7: 133,890,200 E877D possibly damaging Het
Adcy1 T C 11: 7,161,328 I873T probably damaging Het
Adgrg1 C T 8: 95,009,648 H477Y probably damaging Het
Ahctf1 T C 1: 179,795,756 E99G possibly damaging Het
AI314180 T C 4: 58,834,515 S788G probably benign Het
Ankk1 T A 9: 49,417,992 M93L Het
Ankmy1 A T 1: 92,885,250 L446M possibly damaging Het
Anxa10 T A 8: 62,057,791 Y309F probably damaging Het
Arg2 C T 12: 79,150,020 Q172* probably null Het
Atp6v0a4 T A 6: 38,048,991 *834L probably null Het
Avl9 T A 6: 56,753,393 S574T probably benign Het
AW551984 G A 9: 39,599,709 T194I possibly damaging Het
Azin1 G A 15: 38,493,531 L283F probably damaging Het
BC051142 A T 17: 34,448,808 Q158L possibly damaging Het
Birc6 G A 17: 74,609,119 A1677T possibly damaging Het
Carm1 A T 9: 21,586,168 D342V possibly damaging Het
Ccr4 T C 9: 114,492,148 D283G probably damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cntn2 A T 1: 132,522,993 L548Q probably damaging Het
Copg1 A G 6: 87,892,655 D172G probably damaging Het
Cyp2j12 T A 4: 96,121,568 N185Y probably benign Het
Dapk3 T C 10: 81,190,235 L120P probably damaging Het
Dclre1b A C 3: 103,803,982 S204R probably damaging Het
Dennd2a G A 6: 39,523,203 R143* probably null Het
Dnah5 A T 15: 28,289,221 E1185D probably benign Het
Dopey2 C T 16: 93,771,811 T1587I probably damaging Het
Dopey2 A G 16: 93,773,921 T1603A probably benign Het
Dym T A 18: 75,230,018 V531E probably damaging Het
Eif2b4 A T 5: 31,187,930 F453L probably damaging Het
Entpd8 G A 2: 25,084,980 G441D probably damaging Het
Fam71d TGATGTCACAGATGTCAC TGATGTCAC 12: 78,715,283 probably benign Het
Galnt6 A T 15: 100,694,722 Y535N probably damaging Het
Gm10340 T A 14: 3,134,949 D72E possibly damaging Het
Gm13102 T A 4: 144,109,110 D449E probably damaging Het
Hdac9 T A 12: 34,390,221 K386N probably damaging Het
Hgs T A 11: 120,475,218 C212* probably null Het
Hoxa2 C A 6: 52,164,560 A29S possibly damaging Het
Ifnar1 T A 16: 91,499,444 W278R probably damaging Het
Irf7 C T 7: 141,263,509 G389R probably null Het
Lipo1 G A 19: 33,782,204 L211F probably benign Het
Mars2 C T 1: 55,238,582 T448I probably benign Het
Mcm4 C A 16: 15,635,274 G184C probably damaging Het
Mmaa C T 8: 79,267,969 A403T probably damaging Het
Mmel1 A G 4: 154,889,528 I342V probably benign Het
Myb T C 10: 21,150,506 T188A possibly damaging Het
Myo1g C T 11: 6,517,569 probably null Het
Npas2 A G 1: 39,347,627 Q659R probably benign Het
Npr1 A G 3: 90,455,190 V941A probably benign Het
Numa1 T G 7: 101,977,410 M1R probably null Het
Obscn T C 11: 59,076,879 S2700G probably benign Het
Olfr1002 A T 2: 85,648,066 I85N probably benign Het
Olfr721-ps1 T A 14: 14,407,480 L84H probably benign Het
Olfr730 A T 14: 50,186,746 M157K possibly damaging Het
Pdpr T A 8: 111,123,860 H476Q probably damaging Het
Pkd1l1 A T 11: 8,871,805 S1630T Het
Prdm16 A G 4: 154,528,704 S89P probably damaging Het
Ptgdr2 T A 19: 10,940,529 W137R possibly damaging Het
Ptpra A G 2: 130,552,267 I784V possibly damaging Het
Rabepk G T 2: 34,795,176 D77E possibly damaging Het
Sh2b1 GGGGACCAGCTCAGCCACGGGGACCAGCTC GGGGACCAGCTCAGCCACAGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,571 probably benign Het
Smc3 T A 19: 53,641,185 S994T possibly damaging Het
Sparc A G 11: 55,401,957 C147R probably damaging Het
Supt6 A T 11: 78,217,901 D1191E probably benign Het
Susd4 T C 1: 182,892,267 probably null Het
Tbc1d5 A G 17: 50,984,603 probably null Het
Tecta T G 9: 42,366,972 D1080A probably damaging Het
Tenm4 G T 7: 96,902,857 W2538L probably damaging Het
Trappc9 A G 15: 73,012,815 F439L probably benign Het
Vegfa A T 17: 46,031,470 S141T probably benign Het
Vmn2r9 T A 5: 108,849,007 D132V probably benign Het
Wdr60 G T 12: 116,229,642 D563E probably benign Het
Other mutations in Adarb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Adarb2 APN 13 8701725 missense probably benign 0.00
IGL00910:Adarb2 APN 13 8672433 missense probably damaging 1.00
IGL01308:Adarb2 APN 13 8203293 missense possibly damaging 0.93
IGL01337:Adarb2 APN 13 8570246 missense probably benign 0.03
IGL01508:Adarb2 APN 13 8752570 splice site probably null
IGL01792:Adarb2 APN 13 8570149 missense probably damaging 1.00
IGL02387:Adarb2 APN 13 8569958 missense probably damaging 1.00
IGL02423:Adarb2 APN 13 8569720 missense probably damaging 0.99
R0304:Adarb2 UTSW 13 8752570 splice site probably benign
R0463:Adarb2 UTSW 13 8203188 start gained probably benign
R0646:Adarb2 UTSW 13 8731819 missense probably damaging 1.00
R0963:Adarb2 UTSW 13 8672415 missense probably damaging 1.00
R1066:Adarb2 UTSW 13 8757323 missense probably benign 0.14
R1451:Adarb2 UTSW 13 8339621 intron probably benign
R1656:Adarb2 UTSW 13 8203251 missense unknown
R1939:Adarb2 UTSW 13 8203322 critical splice donor site probably null
R2212:Adarb2 UTSW 13 8752618 missense probably damaging 1.00
R2484:Adarb2 UTSW 13 8569774 nonsense probably null
R2993:Adarb2 UTSW 13 8713716 missense probably benign 0.02
R3157:Adarb2 UTSW 13 8697633 missense probably benign 0.20
R3177:Adarb2 UTSW 13 8752627 missense probably damaging 1.00
R3277:Adarb2 UTSW 13 8752627 missense probably damaging 1.00
R3412:Adarb2 UTSW 13 8752618 missense probably damaging 1.00
R3949:Adarb2 UTSW 13 8570419 missense probably damaging 0.97
R4505:Adarb2 UTSW 13 8697691 missense probably damaging 1.00
R5232:Adarb2 UTSW 13 8713640 missense possibly damaging 0.80
R5831:Adarb2 UTSW 13 8559133 missense probably benign 0.45
R7113:Adarb2 UTSW 13 8731845 missense probably damaging 0.99
R7252:Adarb2 UTSW 13 8570180 missense probably benign 0.00
R7259:Adarb2 UTSW 13 8570252 missense probably benign
R7346:Adarb2 UTSW 13 8570384 missense probably damaging 1.00
R7422:Adarb2 UTSW 13 8757277 missense possibly damaging 0.83
R7724:Adarb2 UTSW 13 8570256 missense probably benign 0.34
R7733:Adarb2 UTSW 13 8752608 missense possibly damaging 0.82
R7749:Adarb2 UTSW 13 8569739 missense possibly damaging 0.96
R8746:Adarb2 UTSW 13 8752644 missense probably benign 0.00
Z1177:Adarb2 UTSW 13 8570200 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACGACTGGCTGAACACACTC -3'
(R):5'- TCTTGGAACTAACAGCCCAGGG -3'

Sequencing Primer
(F):5'- GACTGGCTGAACACACTCTCTTC -3'
(R):5'- CTAACAGCCCAGGGAGAAGC -3'
Posted On2021-03-08