Mutagenetix > Incidental Mutation

Incidental Mutation 'R8683:Trappc9'

661910

Institutional Source

Beutler Lab

Gene Symbol

Trappc9

Ensembl Gene

ENSMUSG00000047921

Gene Name

trafficking protein particle complex 9

Synonyms

TRS130, Nibp, 2900005P22Rik, 4632408O18Rik, 1810044A24Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8683 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

72589620-73061204 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 73012815 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 439 (F439L)

Ref Sequence

ENSEMBL: ENSMUSP00000087202 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023276] [ENSMUST00000089770] [ENSMUST00000168191] [ENSMUST00000170633] [ENSMUST00000228960]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000023276
AA Change: F260L

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000023276
Gene: ENSMUSG00000047921
AA Change: F260L

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	2	920	3.6e-239	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000089770
AA Change: F439L

PolyPhen 2 Score 0.257 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000087202
Gene: ENSMUSG00000047921
AA Change: F439L

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	182	350	4.1e-20	PFAM
Pfam:TRAPPC9-Trs120	434	664	2.2e-16	PFAM
low complexity region	993	1004	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000168191
AA Change: F439L

PolyPhen 2 Score 0.261 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000131295
Gene: ENSMUSG00000047921
AA Change: F439L

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	1	810	3.7e-222	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000170633
AA Change: F448L

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000131997
Gene: ENSMUSG00000047921
AA Change: F448L

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	1	820	7.6e-224	PFAM
coiled coil region	857	885	N/A	INTRINSIC
low complexity region	906	929	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000228960
AA Change: F439L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely plays a role in NF-kappa-B signaling. Mutations in this gene have been associated with autosomal-recessive mental retardation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars	A	G	8: 111,042,249	D227G	possibly damaging	Het
Actl11	T	A	9: 107,928,866	D129E	probably benign	Het
Adam12	T	A	7: 133,890,200	E877D	possibly damaging	Het
Adarb2	T	A	13: 8,757,359	V732E	probably damaging	Het
Adcy1	T	C	11: 7,161,328	I873T	probably damaging	Het
Adgrg1	C	T	8: 95,009,648	H477Y	probably damaging	Het
Ahctf1	T	C	1: 179,795,756	E99G	possibly damaging	Het
AI314180	T	C	4: 58,834,515	S788G	probably benign	Het
Ankk1	T	A	9: 49,417,992	M93L		Het
Ankmy1	A	T	1: 92,885,250	L446M	possibly damaging	Het
Anxa10	T	A	8: 62,057,791	Y309F	probably damaging	Het
Arg2	C	T	12: 79,150,020	Q172*	probably null	Het
Atp6v0a4	T	A	6: 38,048,991	*834L	probably null	Het
Avl9	T	A	6: 56,753,393	S574T	probably benign	Het
AW551984	G	A	9: 39,599,709	T194I	possibly damaging	Het
Azin1	G	A	15: 38,493,531	L283F	probably damaging	Het
BC051142	A	T	17: 34,448,808	Q158L	possibly damaging	Het
Birc6	G	A	17: 74,609,119	A1677T	possibly damaging	Het
Carm1	A	T	9: 21,586,168	D342V	possibly damaging	Het
Ccr4	T	C	9: 114,492,148	D283G	probably damaging	Het
Cmtm1	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	8: 104,309,470		probably benign	Het
Cntn2	A	T	1: 132,522,993	L548Q	probably damaging	Het
Copg1	A	G	6: 87,892,655	D172G	probably damaging	Het
Cyp2j12	T	A	4: 96,121,568	N185Y	probably benign	Het
Dapk3	T	C	10: 81,190,235	L120P	probably damaging	Het
Dclre1b	A	C	3: 103,803,982	S204R	probably damaging	Het
Dennd2a	G	A	6: 39,523,203	R143*	probably null	Het
Dnah5	A	T	15: 28,289,221	E1185D	probably benign	Het
Dopey2	C	T	16: 93,771,811	T1587I	probably damaging	Het
Dopey2	A	G	16: 93,773,921	T1603A	probably benign	Het
Dym	T	A	18: 75,230,018	V531E	probably damaging	Het
Eif2b4	A	T	5: 31,187,930	F453L	probably damaging	Het
Entpd8	G	A	2: 25,084,980	G441D	probably damaging	Het
Fam71d	TGATGTCACAGATGTCAC	TGATGTCAC	12: 78,715,283		probably benign	Het
Galnt6	A	T	15: 100,694,722	Y535N	probably damaging	Het
Gm10340	T	A	14: 3,134,949	D72E	possibly damaging	Het
Gm13102	T	A	4: 144,109,110	D449E	probably damaging	Het
Hdac9	T	A	12: 34,390,221	K386N	probably damaging	Het
Hgs	T	A	11: 120,475,218	C212*	probably null	Het
Hoxa2	C	A	6: 52,164,560	A29S	possibly damaging	Het
Ifnar1	T	A	16: 91,499,444	W278R	probably damaging	Het
Irf7	C	T	7: 141,263,509	G389R	probably null	Het
Lipo1	G	A	19: 33,782,204	L211F	probably benign	Het
Mars2	C	T	1: 55,238,582	T448I	probably benign	Het
Mcm4	C	A	16: 15,635,274	G184C	probably damaging	Het
Mmaa	C	T	8: 79,267,969	A403T	probably damaging	Het
Mmel1	A	G	4: 154,889,528	I342V	probably benign	Het
Myb	T	C	10: 21,150,506	T188A	possibly damaging	Het
Myo1g	C	T	11: 6,517,569		probably null	Het
Npas2	A	G	1: 39,347,627	Q659R	probably benign	Het
Npr1	A	G	3: 90,455,190	V941A	probably benign	Het
Numa1	T	G	7: 101,977,410	M1R	probably null	Het
Obscn	T	C	11: 59,076,879	S2700G	probably benign	Het
Olfr1002	A	T	2: 85,648,066	I85N	probably benign	Het
Olfr721-ps1	T	A	14: 14,407,480	L84H	probably benign	Het
Olfr730	A	T	14: 50,186,746	M157K	possibly damaging	Het
Pdpr	T	A	8: 111,123,860	H476Q	probably damaging	Het
Pkd1l1	A	T	11: 8,871,805	S1630T		Het
Prdm16	A	G	4: 154,528,704	S89P	probably damaging	Het
Ptgdr2	T	A	19: 10,940,529	W137R	possibly damaging	Het
Ptpra	A	G	2: 130,552,267	I784V	possibly damaging	Het
Rabepk	G	T	2: 34,795,176	D77E	possibly damaging	Het
Sh2b1	GGGGACCAGCTCAGCCACGGGGACCAGCTC	GGGGACCAGCTCAGCCACAGGGACCAGCTCAGCCACGGGGACCAGCTC	7: 126,467,571		probably benign	Het
Smc3	T	A	19: 53,641,185	S994T	possibly damaging	Het
Sparc	A	G	11: 55,401,957	C147R	probably damaging	Het
Supt6	A	T	11: 78,217,901	D1191E	probably benign	Het
Susd4	T	C	1: 182,892,267		probably null	Het
Tbc1d5	A	G	17: 50,984,603		probably null	Het
Tecta	T	G	9: 42,366,972	D1080A	probably damaging	Het
Tenm4	G	T	7: 96,902,857	W2538L	probably damaging	Het
Vegfa	A	T	17: 46,031,470	S141T	probably benign	Het
Vmn2r9	T	A	5: 108,849,007	D132V	probably benign	Het
Wdr60	G	T	12: 116,229,642	D563E	probably benign	Het

Other mutations in Trappc9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Trappc9	APN	15	73026026	missense	possibly damaging	0.79
IGL01348:Trappc9	APN	15	72937009	missense	possibly damaging	0.64
IGL01367:Trappc9	APN	15	72590153	missense	probably benign	0.31
IGL01521:Trappc9	APN	15	73052167	missense	probably damaging	1.00
IGL01726:Trappc9	APN	15	72946122	missense	probably damaging	0.98
IGL01881:Trappc9	APN	15	72999992	missense	probably damaging	1.00
IGL02214:Trappc9	APN	15	73012882	nonsense	probably null
IGL02693:Trappc9	APN	15	72963693	splice site	probably benign
IGL03229:Trappc9	APN	15	73058456	missense	probably damaging	1.00
basilio	UTSW	15	73058393	missense	probably damaging	1.00
Boomboom	UTSW	15	72736869	nonsense	probably null
bronto	UTSW	15	73058238	nonsense	probably null
Earl	UTSW	15	72736777	nonsense	probably null
Sotto_aceto	UTSW	15	72685339	missense	probably damaging	0.99
P0026:Trappc9	UTSW	15	72953082	missense	probably damaging	1.00
PIT4453001:Trappc9	UTSW	15	73031598	frame shift	probably null
PIT4519001:Trappc9	UTSW	15	72953094	missense	probably benign
R0001:Trappc9	UTSW	15	72963662	missense	probably damaging	1.00
R0094:Trappc9	UTSW	15	72894929	intron	probably benign
R0745:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0747:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0800:Trappc9	UTSW	15	72953132	splice site	probably benign
R0816:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0819:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0820:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0893:Trappc9	UTSW	15	72590107	missense	probably damaging	1.00
R0976:Trappc9	UTSW	15	72999974	missense	probably damaging	0.99
R1119:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1266:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1453:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1454:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1531:Trappc9	UTSW	15	72693548	nonsense	probably null
R1543:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1563:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1565:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1600:Trappc9	UTSW	15	72937109	nonsense	probably null
R1712:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1756:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1789:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1978:Trappc9	UTSW	15	73000025	missense	probably damaging	1.00
R2001:Trappc9	UTSW	15	73058036	missense	probably damaging	0.99
R2312:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R2334:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R2926:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3123:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3124:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3125:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3813:Trappc9	UTSW	15	73058393	missense	probably damaging	1.00
R4012:Trappc9	UTSW	15	73031623	missense	possibly damaging	0.95
R4080:Trappc9	UTSW	15	72941947	missense	probably damaging	1.00
R4282:Trappc9	UTSW	15	72590792	missense	probably damaging	1.00
R4572:Trappc9	UTSW	15	72937067	missense	possibly damaging	0.61
R4739:Trappc9	UTSW	15	72937060	missense	probably damaging	0.97
R4959:Trappc9	UTSW	15	72937056	missense	probably damaging	1.00
R4973:Trappc9	UTSW	15	72937056	missense	probably damaging	1.00
R5123:Trappc9	UTSW	15	72913366	intron	probably benign
R5128:Trappc9	UTSW	15	73058393	missense	probably damaging	1.00
R5228:Trappc9	UTSW	15	73057995	missense	probably damaging	1.00
R5362:Trappc9	UTSW	15	73058217	missense	possibly damaging	0.68
R5802:Trappc9	UTSW	15	72685339	missense	probably damaging	0.99
R6032:Trappc9	UTSW	15	72925530	missense	probably benign	0.43
R6032:Trappc9	UTSW	15	72925530	missense	probably benign	0.43
R6154:Trappc9	UTSW	15	73058081	missense	probably benign	0.03
R6372:Trappc9	UTSW	15	72590074	missense	possibly damaging	0.75
R6661:Trappc9	UTSW	15	72590144	missense	possibly damaging	0.55
R6864:Trappc9	UTSW	15	72937162	splice site	probably null
R6893:Trappc9	UTSW	15	72925650	missense	possibly damaging	0.93
R7099:Trappc9	UTSW	15	72693619	missense	probably benign	0.00
R7276:Trappc9	UTSW	15	73052270	missense	probably damaging	0.99
R7349:Trappc9	UTSW	15	72736869	nonsense	probably null
R8260:Trappc9	UTSW	15	72941909	nonsense	probably null
R8399:Trappc9	UTSW	15	73052282	missense	probably damaging	1.00
R8839:Trappc9	UTSW	15	73058238	nonsense	probably null
R8945:Trappc9	UTSW	15	73058096	missense	probably benign
R9083:Trappc9	UTSW	15	72736777	nonsense	probably null
R9323:Trappc9	UTSW	15	72693582	missense	probably benign	0.41
R9329:Trappc9	UTSW	15	72801353	missense	unknown
R9366:Trappc9	UTSW	15	72937088	missense	probably benign
R9723:Trappc9	UTSW	15	72590114	missense	possibly damaging	0.87
RF008:Trappc9	UTSW	15	72801289	small insertion	probably benign
RF009:Trappc9	UTSW	15	72801287	small insertion	probably benign
RF014:Trappc9	UTSW	15	72801283	small insertion	probably benign
RF016:Trappc9	UTSW	15	72801289	small insertion	probably benign
RF023:Trappc9	UTSW	15	72801324	small insertion	probably benign
RF023:Trappc9	UTSW	15	72801331	small insertion	probably benign
RF028:Trappc9	UTSW	15	72801290	small insertion	probably benign
RF029:Trappc9	UTSW	15	72801323	small insertion	probably benign
RF030:Trappc9	UTSW	15	72801325	small insertion	probably benign
RF034:Trappc9	UTSW	15	72801298	small insertion	probably benign
RF036:Trappc9	UTSW	15	72801320	small insertion	probably benign
RF038:Trappc9	UTSW	15	72801323	small insertion	probably benign
RF040:Trappc9	UTSW	15	72801292	small insertion	probably benign
RF042:Trappc9	UTSW	15	72801283	small insertion	probably benign
RF043:Trappc9	UTSW	15	72801305	small insertion	probably benign
RF049:Trappc9	UTSW	15	72801301	small insertion	probably benign
RF049:Trappc9	UTSW	15	72801306	small insertion	probably benign
RF053:Trappc9	UTSW	15	72801328	small insertion	probably benign
RF057:Trappc9	UTSW	15	72801295	small insertion	probably benign
RF063:Trappc9	UTSW	15	72801320	small insertion	probably benign
RF063:Trappc9	UTSW	15	72801324	small insertion	probably benign
Z1177:Trappc9	UTSW	15	73052162	missense	probably null	0.51

Predicted Primers

PCR Primer
(F):5'- GGCAATTTCTGACCTCCACTAAC -3'
(R):5'- AGCATCCTGTCTGAGCTCTAC -3'

Sequencing Primer
(F):5'- GGGCTCCACGAATTCATGTCAAG -3'
(R):5'- ACGAGCTGATTGGCTTCCAC -3'

Posted On

2021-03-08