Incidental Mutation 'R8683:Trappc9'
ID 661910
Institutional Source Beutler Lab
Gene Symbol Trappc9
Ensembl Gene ENSMUSG00000047921
Gene Name trafficking protein particle complex 9
Synonyms TRS130, Nibp, 2900005P22Rik, 4632408O18Rik, 1810044A24Rik
MMRRC Submission 068538-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8683 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 72461469-72933053 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 72884664 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 439 (F439L)
Ref Sequence ENSEMBL: ENSMUSP00000087202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023276] [ENSMUST00000089770] [ENSMUST00000168191] [ENSMUST00000170633] [ENSMUST00000228960]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000023276
AA Change: F260L

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023276
Gene: ENSMUSG00000047921
AA Change: F260L

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 2 920 3.6e-239 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089770
AA Change: F439L

PolyPhen 2 Score 0.257 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000087202
Gene: ENSMUSG00000047921
AA Change: F439L

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 182 350 4.1e-20 PFAM
Pfam:TRAPPC9-Trs120 434 664 2.2e-16 PFAM
low complexity region 993 1004 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168191
AA Change: F439L

PolyPhen 2 Score 0.261 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000131295
Gene: ENSMUSG00000047921
AA Change: F439L

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 1 810 3.7e-222 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000170633
AA Change: F448L

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000131997
Gene: ENSMUSG00000047921
AA Change: F448L

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 1 820 7.6e-224 PFAM
coiled coil region 857 885 N/A INTRINSIC
low complexity region 906 929 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000228960
AA Change: F439L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely plays a role in NF-kappa-B signaling. Mutations in this gene have been associated with autosomal-recessive mental retardation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars1 A G 8: 111,768,881 (GRCm39) D227G possibly damaging Het
Actl11 T A 9: 107,806,065 (GRCm39) D129E probably benign Het
Adam12 T A 7: 133,491,929 (GRCm39) E877D possibly damaging Het
Adarb2 T A 13: 8,807,395 (GRCm39) V732E probably damaging Het
Adcy1 T C 11: 7,111,328 (GRCm39) I873T probably damaging Het
Adgrg1 C T 8: 95,736,276 (GRCm39) H477Y probably damaging Het
Ahctf1 T C 1: 179,623,321 (GRCm39) E99G possibly damaging Het
Ankk1 T A 9: 49,329,292 (GRCm39) M93L Het
Ankmy1 A T 1: 92,812,972 (GRCm39) L446M possibly damaging Het
Anxa10 T A 8: 62,510,825 (GRCm39) Y309F probably damaging Het
Arg2 C T 12: 79,196,794 (GRCm39) Q172* probably null Het
Atp6v0a4 T A 6: 38,025,926 (GRCm39) *834L probably null Het
Avl9 T A 6: 56,730,378 (GRCm39) S574T probably benign Het
AW551984 G A 9: 39,511,005 (GRCm39) T194I possibly damaging Het
Azin1 G A 15: 38,493,775 (GRCm39) L283F probably damaging Het
Birc6 G A 17: 74,916,114 (GRCm39) A1677T possibly damaging Het
Carm1 A T 9: 21,497,464 (GRCm39) D342V possibly damaging Het
Ccr4 T C 9: 114,321,216 (GRCm39) D283G probably damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 105,036,102 (GRCm39) probably benign Het
Cntn2 A T 1: 132,450,731 (GRCm39) L548Q probably damaging Het
Copg1 A G 6: 87,869,637 (GRCm39) D172G probably damaging Het
Cyp2j12 T A 4: 96,009,805 (GRCm39) N185Y probably benign Het
Dapk3 T C 10: 81,026,069 (GRCm39) L120P probably damaging Het
Dclre1b A C 3: 103,711,298 (GRCm39) S204R probably damaging Het
Dennd2a G A 6: 39,500,137 (GRCm39) R143* probably null Het
Dnah5 A T 15: 28,289,367 (GRCm39) E1185D probably benign Het
Dop1b C T 16: 93,568,699 (GRCm39) T1587I probably damaging Het
Dop1b A G 16: 93,570,809 (GRCm39) T1603A probably benign Het
Dym T A 18: 75,363,089 (GRCm39) V531E probably damaging Het
Dync2i1 G T 12: 116,193,262 (GRCm39) D563E probably benign Het
Ecpas T C 4: 58,834,515 (GRCm39) S788G probably benign Het
Eif2b4 A T 5: 31,345,274 (GRCm39) F453L probably damaging Het
Entpd8 G A 2: 24,974,992 (GRCm39) G441D probably damaging Het
Galnt6 A T 15: 100,592,603 (GRCm39) Y535N probably damaging Het
Garin2 TGATGTCACAGATGTCAC TGATGTCAC 12: 78,762,057 (GRCm39) probably benign Het
Gm10340 T A 14: 14,826,748 (GRCm39) D72E possibly damaging Het
Gm13102 T A 4: 143,835,680 (GRCm39) D449E probably damaging Het
Hdac9 T A 12: 34,440,220 (GRCm39) K386N probably damaging Het
Hgs T A 11: 120,366,044 (GRCm39) C212* probably null Het
Hoxa2 C A 6: 52,141,540 (GRCm39) A29S possibly damaging Het
Ifnar1 T A 16: 91,296,332 (GRCm39) W278R probably damaging Het
Irf7 C T 7: 140,843,422 (GRCm39) G389R probably null Het
Lipo3 G A 19: 33,759,604 (GRCm39) L211F probably benign Het
Mars2 C T 1: 55,277,741 (GRCm39) T448I probably benign Het
Mcm4 C A 16: 15,453,138 (GRCm39) G184C probably damaging Het
Mmaa C T 8: 79,994,598 (GRCm39) A403T probably damaging Het
Mmel1 A G 4: 154,973,985 (GRCm39) I342V probably benign Het
Myb T C 10: 21,026,405 (GRCm39) T188A possibly damaging Het
Myo1g C T 11: 6,467,569 (GRCm39) probably null Het
Npas2 A G 1: 39,386,708 (GRCm39) Q659R probably benign Het
Npr1 A G 3: 90,362,497 (GRCm39) V941A probably benign Het
Numa1 T G 7: 101,626,617 (GRCm39) M1R probably null Het
Obscn T C 11: 58,967,705 (GRCm39) S2700G probably benign Het
Or2t35 T A 14: 14,407,480 (GRCm38) L84H probably benign Het
Or4k2 A T 14: 50,424,203 (GRCm39) M157K possibly damaging Het
Or5g25 A T 2: 85,478,410 (GRCm39) I85N probably benign Het
Pdpr T A 8: 111,850,492 (GRCm39) H476Q probably damaging Het
Pkd1l1 A T 11: 8,821,805 (GRCm39) S1630T Het
Prdm16 A G 4: 154,613,161 (GRCm39) S89P probably damaging Het
Ptgdr2 T A 19: 10,917,893 (GRCm39) W137R possibly damaging Het
Ptpra A G 2: 130,394,187 (GRCm39) I784V possibly damaging Het
Rabepk G T 2: 34,685,188 (GRCm39) D77E possibly damaging Het
Sh2b1 GGGGACCAGCTCAGCCACGGGGACCAGCTC GGGGACCAGCTCAGCCACAGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,066,743 (GRCm39) probably benign Het
Smc3 T A 19: 53,629,616 (GRCm39) S994T possibly damaging Het
Sparc A G 11: 55,292,783 (GRCm39) C147R probably damaging Het
Supt6 A T 11: 78,108,727 (GRCm39) D1191E probably benign Het
Susd4 T C 1: 182,719,832 (GRCm39) probably null Het
Tbc1d5 A G 17: 51,291,631 (GRCm39) probably null Het
Tecta T G 9: 42,278,268 (GRCm39) D1080A probably damaging Het
Tenm4 G T 7: 96,552,064 (GRCm39) W2538L probably damaging Het
Tsbp1 A T 17: 34,667,782 (GRCm39) Q158L possibly damaging Het
Vegfa A T 17: 46,342,396 (GRCm39) S141T probably benign Het
Vmn2r9 T A 5: 108,996,873 (GRCm39) D132V probably benign Het
Other mutations in Trappc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Trappc9 APN 15 72,897,875 (GRCm39) missense possibly damaging 0.79
IGL01348:Trappc9 APN 15 72,808,858 (GRCm39) missense possibly damaging 0.64
IGL01367:Trappc9 APN 15 72,462,002 (GRCm39) missense probably benign 0.31
IGL01521:Trappc9 APN 15 72,924,016 (GRCm39) missense probably damaging 1.00
IGL01726:Trappc9 APN 15 72,817,971 (GRCm39) missense probably damaging 0.98
IGL01881:Trappc9 APN 15 72,871,841 (GRCm39) missense probably damaging 1.00
IGL02214:Trappc9 APN 15 72,884,731 (GRCm39) nonsense probably null
IGL02693:Trappc9 APN 15 72,835,542 (GRCm39) splice site probably benign
IGL03229:Trappc9 APN 15 72,930,305 (GRCm39) missense probably damaging 1.00
basilio UTSW 15 72,930,242 (GRCm39) missense probably damaging 1.00
Boomboom UTSW 15 72,608,718 (GRCm39) nonsense probably null
bronto UTSW 15 72,930,087 (GRCm39) nonsense probably null
Earl UTSW 15 72,608,626 (GRCm39) nonsense probably null
Sotto_aceto UTSW 15 72,557,188 (GRCm39) missense probably damaging 0.99
P0026:Trappc9 UTSW 15 72,824,931 (GRCm39) missense probably damaging 1.00
PIT4453001:Trappc9 UTSW 15 72,903,447 (GRCm39) frame shift probably null
PIT4519001:Trappc9 UTSW 15 72,824,943 (GRCm39) missense probably benign
R0001:Trappc9 UTSW 15 72,835,511 (GRCm39) missense probably damaging 1.00
R0094:Trappc9 UTSW 15 72,894,929 (GRCm38) intron probably benign
R0745:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R0747:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R0800:Trappc9 UTSW 15 72,824,981 (GRCm39) splice site probably benign
R0816:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R0819:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R0820:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R0893:Trappc9 UTSW 15 72,461,956 (GRCm39) missense probably damaging 1.00
R0976:Trappc9 UTSW 15 72,871,823 (GRCm39) missense probably damaging 0.99
R1119:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R1266:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R1453:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R1454:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R1531:Trappc9 UTSW 15 72,565,397 (GRCm39) nonsense probably null
R1543:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R1563:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R1565:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R1600:Trappc9 UTSW 15 72,808,958 (GRCm39) nonsense probably null
R1712:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R1756:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R1789:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R1978:Trappc9 UTSW 15 72,871,874 (GRCm39) missense probably damaging 1.00
R2001:Trappc9 UTSW 15 72,929,885 (GRCm39) missense probably damaging 0.99
R2312:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R2334:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R2926:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R3123:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R3124:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R3125:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R3813:Trappc9 UTSW 15 72,930,242 (GRCm39) missense probably damaging 1.00
R4012:Trappc9 UTSW 15 72,903,472 (GRCm39) missense possibly damaging 0.95
R4080:Trappc9 UTSW 15 72,813,796 (GRCm39) missense probably damaging 1.00
R4282:Trappc9 UTSW 15 72,462,641 (GRCm39) missense probably damaging 1.00
R4572:Trappc9 UTSW 15 72,808,916 (GRCm39) missense possibly damaging 0.61
R4739:Trappc9 UTSW 15 72,808,909 (GRCm39) missense probably damaging 0.97
R4959:Trappc9 UTSW 15 72,808,905 (GRCm39) missense probably damaging 1.00
R4973:Trappc9 UTSW 15 72,808,905 (GRCm39) missense probably damaging 1.00
R5123:Trappc9 UTSW 15 72,785,215 (GRCm39) intron probably benign
R5128:Trappc9 UTSW 15 72,930,242 (GRCm39) missense probably damaging 1.00
R5228:Trappc9 UTSW 15 72,929,844 (GRCm39) missense probably damaging 1.00
R5362:Trappc9 UTSW 15 72,930,066 (GRCm39) missense possibly damaging 0.68
R5802:Trappc9 UTSW 15 72,557,188 (GRCm39) missense probably damaging 0.99
R6032:Trappc9 UTSW 15 72,797,379 (GRCm39) missense probably benign 0.43
R6032:Trappc9 UTSW 15 72,797,379 (GRCm39) missense probably benign 0.43
R6154:Trappc9 UTSW 15 72,929,930 (GRCm39) missense probably benign 0.03
R6372:Trappc9 UTSW 15 72,461,923 (GRCm39) missense possibly damaging 0.75
R6661:Trappc9 UTSW 15 72,461,993 (GRCm39) missense possibly damaging 0.55
R6864:Trappc9 UTSW 15 72,809,011 (GRCm39) splice site probably null
R6893:Trappc9 UTSW 15 72,797,499 (GRCm39) missense possibly damaging 0.93
R7099:Trappc9 UTSW 15 72,565,468 (GRCm39) missense probably benign 0.00
R7276:Trappc9 UTSW 15 72,924,119 (GRCm39) missense probably damaging 0.99
R7349:Trappc9 UTSW 15 72,608,718 (GRCm39) nonsense probably null
R8260:Trappc9 UTSW 15 72,813,758 (GRCm39) nonsense probably null
R8399:Trappc9 UTSW 15 72,924,131 (GRCm39) missense probably damaging 1.00
R8839:Trappc9 UTSW 15 72,930,087 (GRCm39) nonsense probably null
R8945:Trappc9 UTSW 15 72,929,945 (GRCm39) missense probably benign
R9083:Trappc9 UTSW 15 72,608,626 (GRCm39) nonsense probably null
R9323:Trappc9 UTSW 15 72,565,431 (GRCm39) missense probably benign 0.41
R9329:Trappc9 UTSW 15 72,673,202 (GRCm39) missense unknown
R9366:Trappc9 UTSW 15 72,808,937 (GRCm39) missense probably benign
R9723:Trappc9 UTSW 15 72,461,963 (GRCm39) missense possibly damaging 0.87
RF008:Trappc9 UTSW 15 72,673,138 (GRCm39) small insertion probably benign
RF009:Trappc9 UTSW 15 72,673,136 (GRCm39) small insertion probably benign
RF014:Trappc9 UTSW 15 72,673,132 (GRCm39) small insertion probably benign
RF016:Trappc9 UTSW 15 72,673,138 (GRCm39) small insertion probably benign
RF023:Trappc9 UTSW 15 72,673,180 (GRCm39) small insertion probably benign
RF023:Trappc9 UTSW 15 72,673,173 (GRCm39) small insertion probably benign
RF028:Trappc9 UTSW 15 72,673,139 (GRCm39) small insertion probably benign
RF029:Trappc9 UTSW 15 72,673,172 (GRCm39) small insertion probably benign
RF030:Trappc9 UTSW 15 72,673,174 (GRCm39) small insertion probably benign
RF034:Trappc9 UTSW 15 72,673,147 (GRCm39) small insertion probably benign
RF036:Trappc9 UTSW 15 72,673,169 (GRCm39) small insertion probably benign
RF038:Trappc9 UTSW 15 72,673,172 (GRCm39) small insertion probably benign
RF040:Trappc9 UTSW 15 72,673,141 (GRCm39) small insertion probably benign
RF042:Trappc9 UTSW 15 72,673,132 (GRCm39) small insertion probably benign
RF043:Trappc9 UTSW 15 72,673,154 (GRCm39) small insertion probably benign
RF049:Trappc9 UTSW 15 72,673,155 (GRCm39) small insertion probably benign
RF049:Trappc9 UTSW 15 72,673,150 (GRCm39) small insertion probably benign
RF053:Trappc9 UTSW 15 72,673,177 (GRCm39) small insertion probably benign
RF057:Trappc9 UTSW 15 72,673,144 (GRCm39) small insertion probably benign
RF063:Trappc9 UTSW 15 72,673,173 (GRCm39) small insertion probably benign
RF063:Trappc9 UTSW 15 72,673,169 (GRCm39) small insertion probably benign
Z1177:Trappc9 UTSW 15 72,924,011 (GRCm39) missense probably null 0.51
Predicted Primers PCR Primer
(F):5'- GGCAATTTCTGACCTCCACTAAC -3'
(R):5'- AGCATCCTGTCTGAGCTCTAC -3'

Sequencing Primer
(F):5'- GGGCTCCACGAATTCATGTCAAG -3'
(R):5'- ACGAGCTGATTGGCTTCCAC -3'
Posted On 2021-03-08