Mutagenetix > Incidental Mutations

Incidental Mutation 'R8683:Trappc9'

661910

Institutional Source

Beutler Lab

Gene Symbol

Trappc9

Ensembl Gene

ENSMUSG00000047921

Gene Name

trafficking protein particle complex 9

Synonyms

TRS130, Nibp, 2900005P22Rik, 4632408O18Rik, 1810044A24Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8683 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

72589620-73061204 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 73012815 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 439 (F439L)

Ref Sequence

ENSEMBL: ENSMUSP00000087202 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023276] [ENSMUST00000089770] [ENSMUST00000168191] [ENSMUST00000170633] [ENSMUST00000228960]

Predicted Effect

probably damaging
Transcript: ENSMUST00000023276
AA Change: F260L

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000023276
Gene: ENSMUSG00000047921
AA Change: F260L

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	2	920	3.6e-239	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000089770
AA Change: F439L

PolyPhen 2 Score 0.257 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000087202
Gene: ENSMUSG00000047921
AA Change: F439L

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	182	350	4.1e-20	PFAM
Pfam:TRAPPC9-Trs120	434	664	2.2e-16	PFAM
low complexity region	993	1004	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000168191
AA Change: F439L

PolyPhen 2 Score 0.261 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000131295
Gene: ENSMUSG00000047921
AA Change: F439L

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	1	810	3.7e-222	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000170633
AA Change: F448L

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000131997
Gene: ENSMUSG00000047921
AA Change: F448L

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	1	820	7.6e-224	PFAM
coiled coil region	857	885	N/A	INTRINSIC
low complexity region	906	929	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000228960
AA Change: F439L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely plays a role in NF-kappa-B signaling. Mutations in this gene have been associated with autosomal-recessive mental retardation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars	A	G	8: 111,042,249	D227G	possibly damaging	Het
Actl11	T	A	9: 107,928,866	D129E	probably benign	Het
Adam12	T	A	7: 133,890,200	E877D	possibly damaging	Het
Adarb2	T	A	13: 8,757,359	V732E	probably damaging	Het
Adcy1	T	C	11: 7,161,328	I873T	probably damaging	Het
Adgrg1	C	T	8: 95,009,648	H477Y	probably damaging	Het
Ahctf1	T	C	1: 179,795,756	E99G	possibly damaging	Het
AI314180	T	C	4: 58,834,515	S788G	probably benign	Het
Ankk1	T	A	9: 49,417,992	M93L		Het
Ankmy1	A	T	1: 92,885,250	L446M	possibly damaging	Het
Anxa10	T	A	8: 62,057,791	Y309F	probably damaging	Het
Arg2	C	T	12: 79,150,020	Q172*	probably null	Het
Atp6v0a4	T	A	6: 38,048,991	*834L	probably null	Het
Avl9	T	A	6: 56,753,393	S574T	probably benign	Het
AW551984	G	A	9: 39,599,709	T194I	possibly damaging	Het
Azin1	G	A	15: 38,493,531	L283F	probably damaging	Het
BC051142	A	T	17: 34,448,808	Q158L	possibly damaging	Het
Birc6	G	A	17: 74,609,119	A1677T	possibly damaging	Het
Carm1	A	T	9: 21,586,168	D342V	possibly damaging	Het
Ccr4	T	C	9: 114,492,148	D283G	probably damaging	Het
Cmtm1	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	8: 104,309,470		probably benign	Het
Cntn2	A	T	1: 132,522,993	L548Q	probably damaging	Het
Copg1	A	G	6: 87,892,655	D172G	probably damaging	Het
Cyp2j12	T	A	4: 96,121,568	N185Y	probably benign	Het
Dapk3	T	C	10: 81,190,235	L120P	probably damaging	Het
Dclre1b	A	C	3: 103,803,982	S204R	probably damaging	Het
Dennd2a	G	A	6: 39,523,203	R143*	probably null	Het
Dnah5	A	T	15: 28,289,221	E1185D	probably benign	Het
Dopey2	C	T	16: 93,771,811	T1587I	probably damaging	Het
Dopey2	A	G	16: 93,773,921	T1603A	probably benign	Het
Dym	T	A	18: 75,230,018	V531E	probably damaging	Het
Eif2b4	A	T	5: 31,187,930	F453L	probably damaging	Het
Entpd8	G	A	2: 25,084,980	G441D	probably damaging	Het
Fam71d	TGATGTCACAGATGTCAC	TGATGTCAC	12: 78,715,283		probably benign	Het
Galnt6	A	T	15: 100,694,722	Y535N	probably damaging	Het
Gm10340	T	A	14: 3,134,949	D72E	possibly damaging	Het
Gm13102	T	A	4: 144,109,110	D449E	probably damaging	Het
Hdac9	T	A	12: 34,390,221	K386N	probably damaging	Het
Hgs	T	A	11: 120,475,218	C212*	probably null	Het
Hoxa2	C	A	6: 52,164,560	A29S	possibly damaging	Het
Ifnar1	T	A	16: 91,499,444	W278R	probably damaging	Het
Irf7	C	T	7: 141,263,509	G389R	probably null	Het
Lipo1	G	A	19: 33,782,204	L211F	probably benign	Het
Mars2	C	T	1: 55,238,582	T448I	probably benign	Het
Mcm4	C	A	16: 15,635,274	G184C	probably damaging	Het
Mmaa	C	T	8: 79,267,969	A403T	probably damaging	Het
Mmel1	A	G	4: 154,889,528	I342V	probably benign	Het
Myb	T	C	10: 21,150,506	T188A	possibly damaging	Het
Myo1g	C	T	11: 6,517,569		probably null	Het
Npas2	A	G	1: 39,347,627	Q659R	probably benign	Het
Npr1	A	G	3: 90,455,190	V941A	probably benign	Het
Numa1	T	G	7: 101,977,410	M1R	probably null	Het
Obscn	T	C	11: 59,076,879	S2700G	probably benign	Het
Olfr1002	A	T	2: 85,648,066	I85N	probably benign	Het
Olfr721-ps1	T	A	14: 14,407,480	L84H	probably benign	Het
Olfr730	A	T	14: 50,186,746	M157K	possibly damaging	Het
Pdpr	T	A	8: 111,123,860	H476Q	probably damaging	Het
Pkd1l1	A	T	11: 8,871,805	S1630T		Het
Prdm16	A	G	4: 154,528,704	S89P	probably damaging	Het
Ptgdr2	T	A	19: 10,940,529	W137R	possibly damaging	Het
Ptpra	A	G	2: 130,552,267	I784V	possibly damaging	Het
Rabepk	G	T	2: 34,795,176	D77E	possibly damaging	Het
Sh2b1	GGGGACCAGCTCAGCCACGGGGACCAGCTC	GGGGACCAGCTCAGCCACAGGGACCAGCTCAGCCACGGGGACCAGCTC	7: 126,467,571		probably benign	Het
Smc3	T	A	19: 53,641,185	S994T	possibly damaging	Het
Sparc	A	G	11: 55,401,957	C147R	probably damaging	Het
Supt6	A	T	11: 78,217,901	D1191E	probably benign	Het
Susd4	T	C	1: 182,892,267		probably null	Het
Tbc1d5	A	G	17: 50,984,603		probably null	Het
Tecta	T	G	9: 42,366,972	D1080A	probably damaging	Het
Tenm4	G	T	7: 96,902,857	W2538L	probably damaging	Het
Vegfa	A	T	17: 46,031,470	S141T	probably benign	Het
Vmn2r9	T	A	5: 108,849,007	D132V	probably benign	Het
Wdr60	G	T	12: 116,229,642	D563E	probably benign	Het

Other mutations in Trappc9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Trappc9	APN	15	73026026	missense	possibly damaging	0.79
IGL01348:Trappc9	APN	15	72937009	missense	possibly damaging	0.64
IGL01367:Trappc9	APN	15	72590153	missense	probably benign	0.31
IGL01521:Trappc9	APN	15	73052167	missense	probably damaging	1.00
IGL01726:Trappc9	APN	15	72946122	missense	probably damaging	0.98
IGL01881:Trappc9	APN	15	72999992	missense	probably damaging	1.00
IGL02214:Trappc9	APN	15	73012882	nonsense	probably null
IGL02693:Trappc9	APN	15	72963693	splice site	probably benign
IGL03229:Trappc9	APN	15	73058456	missense	probably damaging	1.00
basilio	UTSW	15	73058393	missense	probably damaging	1.00
Boomboom	UTSW	15	72736869	nonsense	probably null
Sotto_aceto	UTSW	15	72685339	missense	probably damaging	0.99
P0026:Trappc9	UTSW	15	72953082	missense	probably damaging	1.00
PIT4453001:Trappc9	UTSW	15	73031598	frame shift	probably null
PIT4519001:Trappc9	UTSW	15	72953094	missense	probably benign
R0001:Trappc9	UTSW	15	72963662	missense	probably damaging	1.00
R0094:Trappc9	UTSW	15	72894929	intron	probably benign
R0745:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0747:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0800:Trappc9	UTSW	15	72953132	splice site	probably benign
R0816:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0819:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0820:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0893:Trappc9	UTSW	15	72590107	missense	probably damaging	1.00
R0976:Trappc9	UTSW	15	72999974	missense	probably damaging	0.99
R1119:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1266:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1453:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1454:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1531:Trappc9	UTSW	15	72693548	nonsense	probably null
R1543:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1563:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1565:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1600:Trappc9	UTSW	15	72937109	nonsense	probably null
R1712:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1756:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1789:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1978:Trappc9	UTSW	15	73000025	missense	probably damaging	1.00
R2001:Trappc9	UTSW	15	73058036	missense	probably damaging	0.99
R2312:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R2334:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R2926:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3123:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3124:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3125:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3813:Trappc9	UTSW	15	73058393	missense	probably damaging	1.00
R4012:Trappc9	UTSW	15	73031623	missense	possibly damaging	0.95
R4080:Trappc9	UTSW	15	72941947	missense	probably damaging	1.00
R4282:Trappc9	UTSW	15	72590792	missense	probably damaging	1.00
R4572:Trappc9	UTSW	15	72937067	missense	possibly damaging	0.61
R4739:Trappc9	UTSW	15	72937060	missense	probably damaging	0.97
R4959:Trappc9	UTSW	15	72937056	missense	probably damaging	1.00
R4973:Trappc9	UTSW	15	72937056	missense	probably damaging	1.00
R5123:Trappc9	UTSW	15	72913366	intron	probably benign
R5128:Trappc9	UTSW	15	73058393	missense	probably damaging	1.00
R5228:Trappc9	UTSW	15	73057995	missense	probably damaging	1.00
R5362:Trappc9	UTSW	15	73058217	missense	possibly damaging	0.68
R5802:Trappc9	UTSW	15	72685339	missense	probably damaging	0.99
R6032:Trappc9	UTSW	15	72925530	missense	probably benign	0.43
R6032:Trappc9	UTSW	15	72925530	missense	probably benign	0.43
R6154:Trappc9	UTSW	15	73058081	missense	probably benign	0.03
R6372:Trappc9	UTSW	15	72590074	missense	possibly damaging	0.75
R6661:Trappc9	UTSW	15	72590144	missense	possibly damaging	0.55
R6864:Trappc9	UTSW	15	72937162	splice site	probably null
R6893:Trappc9	UTSW	15	72925650	missense	possibly damaging	0.93
R7099:Trappc9	UTSW	15	72693619	missense	probably benign	0.00
R7276:Trappc9	UTSW	15	73052270	missense	probably damaging	0.99
R7349:Trappc9	UTSW	15	72736869	nonsense	probably null
R8260:Trappc9	UTSW	15	72941909	nonsense	probably null
R8399:Trappc9	UTSW	15	73052282	missense	probably damaging	1.00
R8839:Trappc9	UTSW	15	73058238	nonsense	probably null
R8945:Trappc9	UTSW	15	73058096	missense	probably benign
RF008:Trappc9	UTSW	15	72801289	small insertion	probably benign
RF009:Trappc9	UTSW	15	72801287	small insertion	probably benign
RF014:Trappc9	UTSW	15	72801283	small insertion	probably benign
RF016:Trappc9	UTSW	15	72801289	small insertion	probably benign
RF023:Trappc9	UTSW	15	72801324	small insertion	probably benign
RF023:Trappc9	UTSW	15	72801331	small insertion	probably benign
RF028:Trappc9	UTSW	15	72801290	small insertion	probably benign
RF029:Trappc9	UTSW	15	72801323	small insertion	probably benign
RF030:Trappc9	UTSW	15	72801325	small insertion	probably benign
RF034:Trappc9	UTSW	15	72801298	small insertion	probably benign
RF036:Trappc9	UTSW	15	72801320	small insertion	probably benign
RF038:Trappc9	UTSW	15	72801323	small insertion	probably benign
RF040:Trappc9	UTSW	15	72801292	small insertion	probably benign
RF042:Trappc9	UTSW	15	72801283	small insertion	probably benign
RF043:Trappc9	UTSW	15	72801305	small insertion	probably benign
RF049:Trappc9	UTSW	15	72801301	small insertion	probably benign
RF049:Trappc9	UTSW	15	72801306	small insertion	probably benign
RF053:Trappc9	UTSW	15	72801328	small insertion	probably benign
RF057:Trappc9	UTSW	15	72801295	small insertion	probably benign
RF063:Trappc9	UTSW	15	72801320	small insertion	probably benign
RF063:Trappc9	UTSW	15	72801324	small insertion	probably benign
Z1177:Trappc9	UTSW	15	73052162	missense	probably null	0.51

Predicted Primers

PCR Primer
(F):5'- GGCAATTTCTGACCTCCACTAAC -3'
(R):5'- AGCATCCTGTCTGAGCTCTAC -3'

Sequencing Primer
(F):5'- GGGCTCCACGAATTCATGTCAAG -3'
(R):5'- ACGAGCTGATTGGCTTCCAC -3'

Posted On

2021-03-08