Incidental Mutation 'R8683:Trappc9'
ID 661910
Institutional Source Beutler Lab
Gene Symbol Trappc9
Ensembl Gene ENSMUSG00000047921
Gene Name trafficking protein particle complex 9
Synonyms TRS130, Nibp, 2900005P22Rik, 4632408O18Rik, 1810044A24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8683 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 72589620-73061204 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 73012815 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 439 (F439L)
Ref Sequence ENSEMBL: ENSMUSP00000087202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023276] [ENSMUST00000089770] [ENSMUST00000168191] [ENSMUST00000170633] [ENSMUST00000228960]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000023276
AA Change: F260L

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023276
Gene: ENSMUSG00000047921
AA Change: F260L

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 2 920 3.6e-239 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089770
AA Change: F439L

PolyPhen 2 Score 0.257 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000087202
Gene: ENSMUSG00000047921
AA Change: F439L

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 182 350 4.1e-20 PFAM
Pfam:TRAPPC9-Trs120 434 664 2.2e-16 PFAM
low complexity region 993 1004 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168191
AA Change: F439L

PolyPhen 2 Score 0.261 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000131295
Gene: ENSMUSG00000047921
AA Change: F439L

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 1 810 3.7e-222 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000170633
AA Change: F448L

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000131997
Gene: ENSMUSG00000047921
AA Change: F448L

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 1 820 7.6e-224 PFAM
coiled coil region 857 885 N/A INTRINSIC
low complexity region 906 929 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000228960
AA Change: F439L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely plays a role in NF-kappa-B signaling. Mutations in this gene have been associated with autosomal-recessive mental retardation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars A G 8: 111,042,249 D227G possibly damaging Het
Actl11 T A 9: 107,928,866 D129E probably benign Het
Adam12 T A 7: 133,890,200 E877D possibly damaging Het
Adarb2 T A 13: 8,757,359 V732E probably damaging Het
Adcy1 T C 11: 7,161,328 I873T probably damaging Het
Adgrg1 C T 8: 95,009,648 H477Y probably damaging Het
Ahctf1 T C 1: 179,795,756 E99G possibly damaging Het
AI314180 T C 4: 58,834,515 S788G probably benign Het
Ankk1 T A 9: 49,417,992 M93L Het
Ankmy1 A T 1: 92,885,250 L446M possibly damaging Het
Anxa10 T A 8: 62,057,791 Y309F probably damaging Het
Arg2 C T 12: 79,150,020 Q172* probably null Het
Atp6v0a4 T A 6: 38,048,991 *834L probably null Het
Avl9 T A 6: 56,753,393 S574T probably benign Het
AW551984 G A 9: 39,599,709 T194I possibly damaging Het
Azin1 G A 15: 38,493,531 L283F probably damaging Het
BC051142 A T 17: 34,448,808 Q158L possibly damaging Het
Birc6 G A 17: 74,609,119 A1677T possibly damaging Het
Carm1 A T 9: 21,586,168 D342V possibly damaging Het
Ccr4 T C 9: 114,492,148 D283G probably damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cntn2 A T 1: 132,522,993 L548Q probably damaging Het
Copg1 A G 6: 87,892,655 D172G probably damaging Het
Cyp2j12 T A 4: 96,121,568 N185Y probably benign Het
Dapk3 T C 10: 81,190,235 L120P probably damaging Het
Dclre1b A C 3: 103,803,982 S204R probably damaging Het
Dennd2a G A 6: 39,523,203 R143* probably null Het
Dnah5 A T 15: 28,289,221 E1185D probably benign Het
Dopey2 C T 16: 93,771,811 T1587I probably damaging Het
Dopey2 A G 16: 93,773,921 T1603A probably benign Het
Dym T A 18: 75,230,018 V531E probably damaging Het
Eif2b4 A T 5: 31,187,930 F453L probably damaging Het
Entpd8 G A 2: 25,084,980 G441D probably damaging Het
Fam71d TGATGTCACAGATGTCAC TGATGTCAC 12: 78,715,283 probably benign Het
Galnt6 A T 15: 100,694,722 Y535N probably damaging Het
Gm10340 T A 14: 3,134,949 D72E possibly damaging Het
Gm13102 T A 4: 144,109,110 D449E probably damaging Het
Hdac9 T A 12: 34,390,221 K386N probably damaging Het
Hgs T A 11: 120,475,218 C212* probably null Het
Hoxa2 C A 6: 52,164,560 A29S possibly damaging Het
Ifnar1 T A 16: 91,499,444 W278R probably damaging Het
Irf7 C T 7: 141,263,509 G389R probably null Het
Lipo1 G A 19: 33,782,204 L211F probably benign Het
Mars2 C T 1: 55,238,582 T448I probably benign Het
Mcm4 C A 16: 15,635,274 G184C probably damaging Het
Mmaa C T 8: 79,267,969 A403T probably damaging Het
Mmel1 A G 4: 154,889,528 I342V probably benign Het
Myb T C 10: 21,150,506 T188A possibly damaging Het
Myo1g C T 11: 6,517,569 probably null Het
Npas2 A G 1: 39,347,627 Q659R probably benign Het
Npr1 A G 3: 90,455,190 V941A probably benign Het
Numa1 T G 7: 101,977,410 M1R probably null Het
Obscn T C 11: 59,076,879 S2700G probably benign Het
Olfr1002 A T 2: 85,648,066 I85N probably benign Het
Olfr721-ps1 T A 14: 14,407,480 L84H probably benign Het
Olfr730 A T 14: 50,186,746 M157K possibly damaging Het
Pdpr T A 8: 111,123,860 H476Q probably damaging Het
Pkd1l1 A T 11: 8,871,805 S1630T Het
Prdm16 A G 4: 154,528,704 S89P probably damaging Het
Ptgdr2 T A 19: 10,940,529 W137R possibly damaging Het
Ptpra A G 2: 130,552,267 I784V possibly damaging Het
Rabepk G T 2: 34,795,176 D77E possibly damaging Het
Sh2b1 GGGGACCAGCTCAGCCACGGGGACCAGCTC GGGGACCAGCTCAGCCACAGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,571 probably benign Het
Smc3 T A 19: 53,641,185 S994T possibly damaging Het
Sparc A G 11: 55,401,957 C147R probably damaging Het
Supt6 A T 11: 78,217,901 D1191E probably benign Het
Susd4 T C 1: 182,892,267 probably null Het
Tbc1d5 A G 17: 50,984,603 probably null Het
Tecta T G 9: 42,366,972 D1080A probably damaging Het
Tenm4 G T 7: 96,902,857 W2538L probably damaging Het
Vegfa A T 17: 46,031,470 S141T probably benign Het
Vmn2r9 T A 5: 108,849,007 D132V probably benign Het
Wdr60 G T 12: 116,229,642 D563E probably benign Het
Other mutations in Trappc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Trappc9 APN 15 73026026 missense possibly damaging 0.79
IGL01348:Trappc9 APN 15 72937009 missense possibly damaging 0.64
IGL01367:Trappc9 APN 15 72590153 missense probably benign 0.31
IGL01521:Trappc9 APN 15 73052167 missense probably damaging 1.00
IGL01726:Trappc9 APN 15 72946122 missense probably damaging 0.98
IGL01881:Trappc9 APN 15 72999992 missense probably damaging 1.00
IGL02214:Trappc9 APN 15 73012882 nonsense probably null
IGL02693:Trappc9 APN 15 72963693 splice site probably benign
IGL03229:Trappc9 APN 15 73058456 missense probably damaging 1.00
basilio UTSW 15 73058393 missense probably damaging 1.00
Boomboom UTSW 15 72736869 nonsense probably null
bronto UTSW 15 73058238 nonsense probably null
Earl UTSW 15 72736777 nonsense probably null
Sotto_aceto UTSW 15 72685339 missense probably damaging 0.99
P0026:Trappc9 UTSW 15 72953082 missense probably damaging 1.00
PIT4453001:Trappc9 UTSW 15 73031598 frame shift probably null
PIT4519001:Trappc9 UTSW 15 72953094 missense probably benign
R0001:Trappc9 UTSW 15 72963662 missense probably damaging 1.00
R0094:Trappc9 UTSW 15 72894929 intron probably benign
R0745:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0747:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0800:Trappc9 UTSW 15 72953132 splice site probably benign
R0816:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0819:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0820:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0893:Trappc9 UTSW 15 72590107 missense probably damaging 1.00
R0976:Trappc9 UTSW 15 72999974 missense probably damaging 0.99
R1119:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1266:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1453:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1454:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1531:Trappc9 UTSW 15 72693548 nonsense probably null
R1543:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1563:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1565:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1600:Trappc9 UTSW 15 72937109 nonsense probably null
R1712:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1756:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1789:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1978:Trappc9 UTSW 15 73000025 missense probably damaging 1.00
R2001:Trappc9 UTSW 15 73058036 missense probably damaging 0.99
R2312:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R2334:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R2926:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3123:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3124:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3125:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3813:Trappc9 UTSW 15 73058393 missense probably damaging 1.00
R4012:Trappc9 UTSW 15 73031623 missense possibly damaging 0.95
R4080:Trappc9 UTSW 15 72941947 missense probably damaging 1.00
R4282:Trappc9 UTSW 15 72590792 missense probably damaging 1.00
R4572:Trappc9 UTSW 15 72937067 missense possibly damaging 0.61
R4739:Trappc9 UTSW 15 72937060 missense probably damaging 0.97
R4959:Trappc9 UTSW 15 72937056 missense probably damaging 1.00
R4973:Trappc9 UTSW 15 72937056 missense probably damaging 1.00
R5123:Trappc9 UTSW 15 72913366 intron probably benign
R5128:Trappc9 UTSW 15 73058393 missense probably damaging 1.00
R5228:Trappc9 UTSW 15 73057995 missense probably damaging 1.00
R5362:Trappc9 UTSW 15 73058217 missense possibly damaging 0.68
R5802:Trappc9 UTSW 15 72685339 missense probably damaging 0.99
R6032:Trappc9 UTSW 15 72925530 missense probably benign 0.43
R6032:Trappc9 UTSW 15 72925530 missense probably benign 0.43
R6154:Trappc9 UTSW 15 73058081 missense probably benign 0.03
R6372:Trappc9 UTSW 15 72590074 missense possibly damaging 0.75
R6661:Trappc9 UTSW 15 72590144 missense possibly damaging 0.55
R6864:Trappc9 UTSW 15 72937162 splice site probably null
R6893:Trappc9 UTSW 15 72925650 missense possibly damaging 0.93
R7099:Trappc9 UTSW 15 72693619 missense probably benign 0.00
R7276:Trappc9 UTSW 15 73052270 missense probably damaging 0.99
R7349:Trappc9 UTSW 15 72736869 nonsense probably null
R8260:Trappc9 UTSW 15 72941909 nonsense probably null
R8399:Trappc9 UTSW 15 73052282 missense probably damaging 1.00
R8839:Trappc9 UTSW 15 73058238 nonsense probably null
R8945:Trappc9 UTSW 15 73058096 missense probably benign
R9083:Trappc9 UTSW 15 72736777 nonsense probably null
R9323:Trappc9 UTSW 15 72693582 missense probably benign 0.41
R9329:Trappc9 UTSW 15 72801353 missense unknown
R9366:Trappc9 UTSW 15 72937088 missense probably benign
R9723:Trappc9 UTSW 15 72590114 missense possibly damaging 0.87
RF008:Trappc9 UTSW 15 72801289 small insertion probably benign
RF009:Trappc9 UTSW 15 72801287 small insertion probably benign
RF014:Trappc9 UTSW 15 72801283 small insertion probably benign
RF016:Trappc9 UTSW 15 72801289 small insertion probably benign
RF023:Trappc9 UTSW 15 72801324 small insertion probably benign
RF023:Trappc9 UTSW 15 72801331 small insertion probably benign
RF028:Trappc9 UTSW 15 72801290 small insertion probably benign
RF029:Trappc9 UTSW 15 72801323 small insertion probably benign
RF030:Trappc9 UTSW 15 72801325 small insertion probably benign
RF034:Trappc9 UTSW 15 72801298 small insertion probably benign
RF036:Trappc9 UTSW 15 72801320 small insertion probably benign
RF038:Trappc9 UTSW 15 72801323 small insertion probably benign
RF040:Trappc9 UTSW 15 72801292 small insertion probably benign
RF042:Trappc9 UTSW 15 72801283 small insertion probably benign
RF043:Trappc9 UTSW 15 72801305 small insertion probably benign
RF049:Trappc9 UTSW 15 72801301 small insertion probably benign
RF049:Trappc9 UTSW 15 72801306 small insertion probably benign
RF053:Trappc9 UTSW 15 72801328 small insertion probably benign
RF057:Trappc9 UTSW 15 72801295 small insertion probably benign
RF063:Trappc9 UTSW 15 72801320 small insertion probably benign
RF063:Trappc9 UTSW 15 72801324 small insertion probably benign
Z1177:Trappc9 UTSW 15 73052162 missense probably null 0.51
Predicted Primers PCR Primer
(F):5'- GGCAATTTCTGACCTCCACTAAC -3'
(R):5'- AGCATCCTGTCTGAGCTCTAC -3'

Sequencing Primer
(F):5'- GGGCTCCACGAATTCATGTCAAG -3'
(R):5'- ACGAGCTGATTGGCTTCCAC -3'
Posted On 2021-03-08