Incidental Mutation 'R8683:Tbc1d5'
ID 661918
Institutional Source Beutler Lab
Gene Symbol Tbc1d5
Ensembl Gene ENSMUSG00000023923
Gene Name TBC1 domain family, member 5
Synonyms 1600014N05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8683 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 50733124-51179352 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 50984603 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000024717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024717] [ENSMUST00000224528]
AlphaFold Q80XQ2
Predicted Effect probably null
Transcript: ENSMUST00000024717
SMART Domains Protein: ENSMUSP00000024717
Gene: ENSMUSG00000023923

DomainStartEndE-ValueType
TBC 78 384 5.56e-86 SMART
low complexity region 475 492 N/A INTRINSIC
SCOP:d1lsha3 511 546 1e-3 SMART
low complexity region 556 568 N/A INTRINSIC
low complexity region 783 802 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224528
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars A G 8: 111,042,249 D227G possibly damaging Het
Actl11 T A 9: 107,928,866 D129E probably benign Het
Adam12 T A 7: 133,890,200 E877D possibly damaging Het
Adarb2 T A 13: 8,757,359 V732E probably damaging Het
Adcy1 T C 11: 7,161,328 I873T probably damaging Het
Adgrg1 C T 8: 95,009,648 H477Y probably damaging Het
Ahctf1 T C 1: 179,795,756 E99G possibly damaging Het
AI314180 T C 4: 58,834,515 S788G probably benign Het
Ankk1 T A 9: 49,417,992 M93L Het
Ankmy1 A T 1: 92,885,250 L446M possibly damaging Het
Anxa10 T A 8: 62,057,791 Y309F probably damaging Het
Arg2 C T 12: 79,150,020 Q172* probably null Het
Atp6v0a4 T A 6: 38,048,991 *834L probably null Het
Avl9 T A 6: 56,753,393 S574T probably benign Het
AW551984 G A 9: 39,599,709 T194I possibly damaging Het
Azin1 G A 15: 38,493,531 L283F probably damaging Het
BC051142 A T 17: 34,448,808 Q158L possibly damaging Het
Birc6 G A 17: 74,609,119 A1677T possibly damaging Het
Carm1 A T 9: 21,586,168 D342V possibly damaging Het
Ccr4 T C 9: 114,492,148 D283G probably damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cntn2 A T 1: 132,522,993 L548Q probably damaging Het
Copg1 A G 6: 87,892,655 D172G probably damaging Het
Cyp2j12 T A 4: 96,121,568 N185Y probably benign Het
Dapk3 T C 10: 81,190,235 L120P probably damaging Het
Dclre1b A C 3: 103,803,982 S204R probably damaging Het
Dennd2a G A 6: 39,523,203 R143* probably null Het
Dnah5 A T 15: 28,289,221 E1185D probably benign Het
Dopey2 C T 16: 93,771,811 T1587I probably damaging Het
Dopey2 A G 16: 93,773,921 T1603A probably benign Het
Dym T A 18: 75,230,018 V531E probably damaging Het
Eif2b4 A T 5: 31,187,930 F453L probably damaging Het
Entpd8 G A 2: 25,084,980 G441D probably damaging Het
Fam71d TGATGTCACAGATGTCAC TGATGTCAC 12: 78,715,283 probably benign Het
Galnt6 A T 15: 100,694,722 Y535N probably damaging Het
Gm10340 T A 14: 3,134,949 D72E possibly damaging Het
Gm13102 T A 4: 144,109,110 D449E probably damaging Het
Hdac9 T A 12: 34,390,221 K386N probably damaging Het
Hgs T A 11: 120,475,218 C212* probably null Het
Hoxa2 C A 6: 52,164,560 A29S possibly damaging Het
Ifnar1 T A 16: 91,499,444 W278R probably damaging Het
Irf7 C T 7: 141,263,509 G389R probably null Het
Lipo1 G A 19: 33,782,204 L211F probably benign Het
Mars2 C T 1: 55,238,582 T448I probably benign Het
Mcm4 C A 16: 15,635,274 G184C probably damaging Het
Mmaa C T 8: 79,267,969 A403T probably damaging Het
Mmel1 A G 4: 154,889,528 I342V probably benign Het
Myb T C 10: 21,150,506 T188A possibly damaging Het
Myo1g C T 11: 6,517,569 probably null Het
Npas2 A G 1: 39,347,627 Q659R probably benign Het
Npr1 A G 3: 90,455,190 V941A probably benign Het
Numa1 T G 7: 101,977,410 M1R probably null Het
Obscn T C 11: 59,076,879 S2700G probably benign Het
Olfr1002 A T 2: 85,648,066 I85N probably benign Het
Olfr721-ps1 T A 14: 14,407,480 L84H probably benign Het
Olfr730 A T 14: 50,186,746 M157K possibly damaging Het
Pdpr T A 8: 111,123,860 H476Q probably damaging Het
Pkd1l1 A T 11: 8,871,805 S1630T Het
Prdm16 A G 4: 154,528,704 S89P probably damaging Het
Ptgdr2 T A 19: 10,940,529 W137R possibly damaging Het
Ptpra A G 2: 130,552,267 I784V possibly damaging Het
Rabepk G T 2: 34,795,176 D77E possibly damaging Het
Sh2b1 GGGGACCAGCTCAGCCACGGGGACCAGCTC GGGGACCAGCTCAGCCACAGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,571 probably benign Het
Smc3 T A 19: 53,641,185 S994T possibly damaging Het
Sparc A G 11: 55,401,957 C147R probably damaging Het
Supt6 A T 11: 78,217,901 D1191E probably benign Het
Susd4 T C 1: 182,892,267 probably null Het
Tecta T G 9: 42,366,972 D1080A probably damaging Het
Tenm4 G T 7: 96,902,857 W2538L probably damaging Het
Trappc9 A G 15: 73,012,815 F439L probably benign Het
Vegfa A T 17: 46,031,470 S141T probably benign Het
Vmn2r9 T A 5: 108,849,007 D132V probably benign Het
Wdr60 G T 12: 116,229,642 D563E probably benign Het
Other mutations in Tbc1d5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Tbc1d5 APN 17 50813798 missense possibly damaging 0.52
IGL01370:Tbc1d5 APN 17 50966727 missense probably benign 0.18
IGL01625:Tbc1d5 APN 17 50917573 missense probably benign 0.27
IGL01935:Tbc1d5 APN 17 50963765 splice site probably benign
IGL02229:Tbc1d5 APN 17 50852600 missense probably damaging 1.00
IGL02811:Tbc1d5 APN 17 50800121 missense probably damaging 0.99
IGL03192:Tbc1d5 APN 17 50984681 splice site probably benign
FR4976:Tbc1d5 UTSW 17 50799931 missense probably benign
FR4976:Tbc1d5 UTSW 17 50799943 missense probably benign 0.01
IGL02796:Tbc1d5 UTSW 17 50966624 missense probably damaging 1.00
R0153:Tbc1d5 UTSW 17 50984687 splice site probably benign
R0326:Tbc1d5 UTSW 17 50966736 missense probably damaging 1.00
R0417:Tbc1d5 UTSW 17 50756705 missense probably benign 0.18
R0481:Tbc1d5 UTSW 17 50919051 missense probably damaging 0.98
R1143:Tbc1d5 UTSW 17 50742059 nonsense probably null
R1533:Tbc1d5 UTSW 17 50920575 missense possibly damaging 0.89
R1543:Tbc1d5 UTSW 17 50935532 missense probably benign 0.32
R2888:Tbc1d5 UTSW 17 50935549 missense probably damaging 1.00
R3153:Tbc1d5 UTSW 17 50968236 missense probably damaging 1.00
R3430:Tbc1d5 UTSW 17 50800128 missense probably damaging 1.00
R3898:Tbc1d5 UTSW 17 50963744 missense probably damaging 0.98
R4116:Tbc1d5 UTSW 17 50920587 missense probably damaging 1.00
R4352:Tbc1d5 UTSW 17 50782401 missense probably damaging 0.98
R4456:Tbc1d5 UTSW 17 50782341 missense probably damaging 1.00
R4648:Tbc1d5 UTSW 17 50736223 missense probably benign
R4711:Tbc1d5 UTSW 17 50935509 missense probably damaging 0.98
R4754:Tbc1d5 UTSW 17 50800165 missense probably benign 0.03
R5303:Tbc1d5 UTSW 17 50736200 missense probably benign 0.00
R5360:Tbc1d5 UTSW 17 50984632 missense probably benign 0.26
R5443:Tbc1d5 UTSW 17 50735967 missense probably damaging 0.98
R5444:Tbc1d5 UTSW 17 50735967 missense probably damaging 0.98
R5611:Tbc1d5 UTSW 17 50735967 missense probably damaging 0.98
R5658:Tbc1d5 UTSW 17 50813841 missense probably benign 0.18
R5701:Tbc1d5 UTSW 17 50799955 small deletion probably benign
R5921:Tbc1d5 UTSW 17 50963693 missense probably damaging 1.00
R6280:Tbc1d5 UTSW 17 50782310 missense probably benign 0.01
R6628:Tbc1d5 UTSW 17 50736208 missense probably benign
R6705:Tbc1d5 UTSW 17 51025175 start gained probably benign
R6990:Tbc1d5 UTSW 17 50968232 missense probably benign 0.19
R7184:Tbc1d5 UTSW 17 50800082 missense probably benign 0.00
R7443:Tbc1d5 UTSW 17 50966735 missense probably damaging 1.00
R7484:Tbc1d5 UTSW 17 50917545 missense possibly damaging 0.68
R7696:Tbc1d5 UTSW 17 50874577 missense probably damaging 1.00
R7787:Tbc1d5 UTSW 17 50874683 nonsense probably null
R7827:Tbc1d5 UTSW 17 50782263 missense probably damaging 0.99
R7841:Tbc1d5 UTSW 17 50799922 small deletion probably benign
R7861:Tbc1d5 UTSW 17 50756692 missense probably damaging 0.99
R7931:Tbc1d5 UTSW 17 50799864 splice site probably benign
R8108:Tbc1d5 UTSW 17 50742086 missense probably benign 0.01
R8434:Tbc1d5 UTSW 17 50782427 splice site probably benign
R8792:Tbc1d5 UTSW 17 50799934 small insertion probably benign
R8799:Tbc1d5 UTSW 17 50799934 small insertion probably benign
R8799:Tbc1d5 UTSW 17 50799935 small insertion probably benign
R8799:Tbc1d5 UTSW 17 50799941 small insertion probably benign
R8799:Tbc1d5 UTSW 17 50799950 small insertion probably benign
R8848:Tbc1d5 UTSW 17 50919054 missense probably damaging 1.00
R9027:Tbc1d5 UTSW 17 50756664 missense probably damaging 0.97
R9176:Tbc1d5 UTSW 17 50782335 missense probably benign
R9751:Tbc1d5 UTSW 17 50874652 missense possibly damaging 0.65
Z1088:Tbc1d5 UTSW 17 50963696 missense probably damaging 1.00
Z1177:Tbc1d5 UTSW 17 50966553 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCAGACTGTCGTGTACCAC -3'
(R):5'- GCTCTGAGTACAAAAGATAATTGGG -3'

Sequencing Primer
(F):5'- GACTGTCGTGTACCACAAAGTC -3'
(R):5'- TAATTGGGAAGATAGAAAAGGGCAG -3'
Posted On 2021-03-08