Incidental Mutation 'R8684:Mov10'
ID661934
Institutional Source Beutler Lab
Gene Symbol Mov10
Ensembl Gene ENSMUSG00000002227
Gene NameMoloney leukemia virus 10
SynonymsMov-10
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.872) question?
Stock #R8684 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location104794836-104818563 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104804374 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 199 (H199R)
Ref Sequence ENSEMBL: ENSMUSP00000128246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002297] [ENSMUST00000106774] [ENSMUST00000106775] [ENSMUST00000136148] [ENSMUST00000166979] [ENSMUST00000168015]
Predicted Effect probably benign
Transcript: ENSMUST00000002297
AA Change: H199R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000002297
Gene: ENSMUSG00000002227
AA Change: H199R

DomainStartEndE-ValueType
low complexity region 297 312 N/A INTRINSIC
low complexity region 338 353 N/A INTRINSIC
AAA 517 699 5.72e-3 SMART
low complexity region 953 970 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106774
SMART Domains Protein: ENSMUSP00000102386
Gene: ENSMUSG00000002227

DomainStartEndE-ValueType
low complexity region 297 312 N/A INTRINSIC
low complexity region 338 353 N/A INTRINSIC
AAA 517 699 5.72e-3 SMART
low complexity region 953 970 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106775
AA Change: H272R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102387
Gene: ENSMUSG00000002227
AA Change: H272R

DomainStartEndE-ValueType
low complexity region 297 312 N/A INTRINSIC
low complexity region 338 353 N/A INTRINSIC
AAA 517 699 5.72e-3 SMART
low complexity region 953 970 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136148
Predicted Effect probably benign
Transcript: ENSMUST00000166979
AA Change: H272R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000126897
Gene: ENSMUSG00000002227
AA Change: H272R

DomainStartEndE-ValueType
low complexity region 61 75 N/A INTRINSIC
low complexity region 370 385 N/A INTRINSIC
low complexity region 411 426 N/A INTRINSIC
AAA 590 772 5.72e-3 SMART
low complexity region 1026 1043 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168015
AA Change: H199R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128246
Gene: ENSMUSG00000002227
AA Change: H199R

DomainStartEndE-ValueType
low complexity region 297 312 N/A INTRINSIC
low complexity region 338 353 N/A INTRINSIC
AAA 517 699 5.72e-3 SMART
low complexity region 953 970 N/A INTRINSIC
Meta Mutation Damage Score 0.0620 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (47/47)
MGI Phenotype PHENOTYPE: Homozygous knockout is embryonic lethal. Heterozygous knockout leads to reduced dendritic branching of neurons, which affects anxiety- and/or activity-related behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933421I07Rik C T 7: 42,447,989 R27H probably benign Het
5430419D17Rik C A 7: 131,235,959 S528* probably null Het
Abca2 T A 2: 25,446,496 L2229Q possibly damaging Het
Adamts4 A T 1: 171,258,972 T778S probably damaging Het
AY358078 T G 14: 51,822,140 Y311* probably null Het
Catsperg1 C T 7: 29,198,400 V181M probably damaging Het
Cep70 A G 9: 99,263,789 K170E possibly damaging Het
Coro1b T A 19: 4,149,528 V62E probably damaging Het
Dnajc11 T C 4: 151,980,726 *560Q probably null Het
Eci3 T C 13: 34,959,891 N84D probably damaging Het
F5 T A 1: 164,217,542 V2133E probably benign Het
Fancl C A 11: 26,470,826 P116Q Het
Gm10801 ATTTTCAGTTTTCTTGCCATATTCCACGTCCTGCACTGGACATTTCTAAATTTTCCACCTTTTTCAGTTTTC ATTTTCAGTTTTC 2: 98,662,324 probably null Het
Golgb1 C T 16: 36,914,402 T1378M possibly damaging Het
Hdac5 T C 11: 102,205,321 N342S probably benign Het
Herc3 A G 6: 58,887,576 K732E probably damaging Het
Lce1e A T 3: 92,707,962 I26N unknown Het
Lingo1 T C 9: 56,620,822 Y167C probably damaging Het
Loxl3 A G 6: 83,035,585 E35G probably benign Het
Mmp13 A G 9: 7,282,089 M464V possibly damaging Het
Nbas A G 12: 13,336,367 T765A probably damaging Het
Nlgn3 C T X: 101,319,819 R679* probably null Het
Nrp1 C T 8: 128,359,404 probably benign Het
Nup88 C A 11: 70,969,861 V31L probably benign Het
Olfr1167 T C 2: 88,149,528 T164A probably benign Het
Olfr1352 A T 10: 78,984,378 D196V probably benign Het
Olfr458 T C 6: 42,460,893 N42S probably damaging Het
Pah A G 10: 87,578,965 N393S probably benign Het
Peli3 T C 19: 4,934,994 Y163C probably damaging Het
Rasgef1b A T 5: 99,377,135 M55K probably benign Het
Ror2 T C 13: 53,110,266 D930G possibly damaging Het
Rpgrip1l T G 8: 91,273,701 M537L probably benign Het
Ryr2 A T 13: 11,687,989 V2871E probably damaging Het
Smco1 A T 16: 32,274,023 N171Y probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Sox2 T A 3: 34,650,867 L151Q probably benign Het
Spink5 A G 18: 44,010,238 E754G probably benign Het
Sulf1 A T 1: 12,796,780 M63L probably benign Het
Traf2 A G 2: 25,520,446 M390T probably damaging Het
Trav13d-4 T C 14: 53,072,809 V16A probably damaging Het
Trmo C T 4: 46,386,251 W84* probably null Het
Trmo T C 4: 46,386,253 probably null Het
Ttyh1 T A 7: 4,130,792 probably benign Het
Ush2a A G 1: 188,911,023 N4194S possibly damaging Het
Vmn2r45 T C 7: 8,483,512 Y259C probably damaging Het
Vmn2r94 T A 17: 18,277,650 probably benign Het
Zfp101 A G 17: 33,382,003 S260P possibly damaging Het
Other mutations in Mov10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Mov10 APN 3 104800947 splice site probably benign
IGL01111:Mov10 APN 3 104801405 missense possibly damaging 0.71
IGL01315:Mov10 APN 3 104795945 missense probably damaging 0.98
IGL01463:Mov10 APN 3 104800324 missense probably damaging 1.00
IGL02114:Mov10 APN 3 104795318 unclassified probably benign
IGL02354:Mov10 APN 3 104804121 splice site probably benign
IGL02361:Mov10 APN 3 104804121 splice site probably benign
IGL02692:Mov10 APN 3 104800803 nonsense probably null
IGL03104:Mov10 APN 3 104797307 missense probably damaging 1.00
IGL03121:Mov10 APN 3 104801002 missense probably benign
P0040:Mov10 UTSW 3 104804679 missense probably damaging 1.00
R0025:Mov10 UTSW 3 104804603 missense probably damaging 1.00
R0270:Mov10 UTSW 3 104795405 missense probably benign 0.09
R0747:Mov10 UTSW 3 104802496 missense probably benign 0.41
R1434:Mov10 UTSW 3 104795174 missense probably damaging 1.00
R1482:Mov10 UTSW 3 104804546 missense probably damaging 0.98
R1594:Mov10 UTSW 3 104795411 missense probably damaging 1.00
R1656:Mov10 UTSW 3 104799596 missense probably benign 0.03
R1739:Mov10 UTSW 3 104800282 missense probably damaging 0.98
R1785:Mov10 UTSW 3 104818116 missense possibly damaging 0.73
R1786:Mov10 UTSW 3 104818116 missense possibly damaging 0.73
R1911:Mov10 UTSW 3 104801560 splice site probably benign
R1962:Mov10 UTSW 3 104796977 missense probably damaging 1.00
R1993:Mov10 UTSW 3 104799419 missense probably damaging 1.00
R2095:Mov10 UTSW 3 104801531 missense probably damaging 1.00
R2138:Mov10 UTSW 3 104804242 missense probably benign 0.00
R3107:Mov10 UTSW 3 104799724 missense probably damaging 1.00
R4241:Mov10 UTSW 3 104797276 missense probably benign 0.45
R4280:Mov10 UTSW 3 104799779 missense probably damaging 0.98
R4474:Mov10 UTSW 3 104818465 missense probably damaging 1.00
R5227:Mov10 UTSW 3 104802578 missense probably benign
R5391:Mov10 UTSW 3 104802533 missense probably benign 0.12
R5704:Mov10 UTSW 3 104799596 missense probably benign 0.03
R5819:Mov10 UTSW 3 104801512 missense probably damaging 1.00
R5842:Mov10 UTSW 3 104799379 splice site probably benign
R6059:Mov10 UTSW 3 104817950 utr 3 prime probably benign
R6692:Mov10 UTSW 3 104818044 missense probably damaging 0.97
R7226:Mov10 UTSW 3 104801012 missense probably damaging 1.00
R7426:Mov10 UTSW 3 104800052 splice site probably null
R7633:Mov10 UTSW 3 104797065 missense possibly damaging 0.93
R7637:Mov10 UTSW 3 104795885 missense probably benign 0.26
R7869:Mov10 UTSW 3 104804678 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCGGTTGGTCAACACAGAG -3'
(R):5'- ACCTATTCCCACTGTGCTGG -3'

Sequencing Primer
(F):5'- CGGTTGGTCAACACAGAGTTTCTG -3'
(R):5'- TGGACGCCCCAGTTTGTC -3'
Posted On2021-03-08