Incidental Mutation 'R8684:Trmo'
ID661936
Institutional Source Beutler Lab
Gene Symbol Trmo
Ensembl Gene ENSMUSG00000028331
Gene NametRNA methyltransferase O
Synonyms5830415F09Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8684 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location46376505-46389437 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 46386253 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000083752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030015] [ENSMUST00000086563] [ENSMUST00000151903]
Predicted Effect probably benign
Transcript: ENSMUST00000030015
SMART Domains Protein: ENSMUSP00000030015
Gene: ENSMUSG00000028331

DomainStartEndE-ValueType
Pfam:UPF0066 42 165 2.3e-45 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000086563
SMART Domains Protein: ENSMUSP00000083752
Gene: ENSMUSG00000028331

DomainStartEndE-ValueType
Pfam:UPF0066 44 164 1.2e-46 PFAM
low complexity region 431 442 N/A INTRINSIC
low complexity region 443 456 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151903
SMART Domains Protein: ENSMUSP00000119785
Gene: ENSMUSG00000028331

DomainStartEndE-ValueType
Pfam:UPF0066 49 172 4.1e-45 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933421I07Rik C T 7: 42,447,989 R27H probably benign Het
5430419D17Rik C A 7: 131,235,959 S528* probably null Het
Abca2 T A 2: 25,446,496 L2229Q possibly damaging Het
Adamts4 A T 1: 171,258,972 T778S probably damaging Het
AY358078 T G 14: 51,822,140 Y311* probably null Het
Catsperg1 C T 7: 29,198,400 V181M probably damaging Het
Cep70 A G 9: 99,263,789 K170E possibly damaging Het
Coro1b T A 19: 4,149,528 V62E probably damaging Het
Dnajc11 T C 4: 151,980,726 *560Q probably null Het
Eci3 T C 13: 34,959,891 N84D probably damaging Het
F5 T A 1: 164,217,542 V2133E probably benign Het
Fancl C A 11: 26,470,826 P116Q Het
Gm10801 ATTTTCAGTTTTCTTGCCATATTCCACGTCCTGCACTGGACATTTCTAAATTTTCCACCTTTTTCAGTTTTC ATTTTCAGTTTTC 2: 98,662,324 probably null Het
Golgb1 C T 16: 36,914,402 T1378M possibly damaging Het
Hdac5 T C 11: 102,205,321 N342S probably benign Het
Herc3 A G 6: 58,887,576 K732E probably damaging Het
Lce1e A T 3: 92,707,962 I26N unknown Het
Lingo1 T C 9: 56,620,822 Y167C probably damaging Het
Loxl3 A G 6: 83,035,585 E35G probably benign Het
Mmp13 A G 9: 7,282,089 M464V possibly damaging Het
Mov10 T C 3: 104,804,374 H199R probably benign Het
Nbas A G 12: 13,336,367 T765A probably damaging Het
Nlgn3 C T X: 101,319,819 R679* probably null Het
Nrp1 C T 8: 128,359,404 probably benign Het
Nup88 C A 11: 70,969,861 V31L probably benign Het
Olfr1167 T C 2: 88,149,528 T164A probably benign Het
Olfr1352 A T 10: 78,984,378 D196V probably benign Het
Olfr458 T C 6: 42,460,893 N42S probably damaging Het
Pah A G 10: 87,578,965 N393S probably benign Het
Peli3 T C 19: 4,934,994 Y163C probably damaging Het
Rasgef1b A T 5: 99,377,135 M55K probably benign Het
Ror2 T C 13: 53,110,266 D930G possibly damaging Het
Rpgrip1l T G 8: 91,273,701 M537L probably benign Het
Ryr2 A T 13: 11,687,989 V2871E probably damaging Het
Smco1 A T 16: 32,274,023 N171Y probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Sox2 T A 3: 34,650,867 L151Q probably benign Het
Spink5 A G 18: 44,010,238 E754G probably benign Het
Sulf1 A T 1: 12,796,780 M63L probably benign Het
Traf2 A G 2: 25,520,446 M390T probably damaging Het
Trav13d-4 T C 14: 53,072,809 V16A probably damaging Het
Ttyh1 T A 7: 4,130,792 probably benign Het
Ush2a A G 1: 188,911,023 N4194S possibly damaging Het
Vmn2r45 T C 7: 8,483,512 Y259C probably damaging Het
Vmn2r94 T A 17: 18,277,650 probably benign Het
Zfp101 A G 17: 33,382,003 S260P possibly damaging Het
Other mutations in Trmo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Trmo APN 4 46382490 missense probably benign
IGL01296:Trmo APN 4 46387589 missense probably damaging 1.00
IGL01308:Trmo APN 4 46377053 utr 3 prime probably benign
IGL01544:Trmo APN 4 46386169 missense probably damaging 1.00
IGL01545:Trmo APN 4 46386169 missense probably damaging 1.00
IGL01722:Trmo APN 4 46386092 critical splice donor site probably null
IGL02085:Trmo APN 4 46380217 missense probably damaging 1.00
IGL02927:Trmo APN 4 46387602 missense probably damaging 1.00
R0645:Trmo UTSW 4 46377083 utr 3 prime probably benign
R0745:Trmo UTSW 4 46382104 missense probably damaging 1.00
R1365:Trmo UTSW 4 46380278 missense probably damaging 1.00
R1835:Trmo UTSW 4 46380158 missense probably damaging 1.00
R3928:Trmo UTSW 4 46382647 missense probably damaging 1.00
R3929:Trmo UTSW 4 46382647 missense probably damaging 1.00
R4497:Trmo UTSW 4 46382140 missense probably damaging 1.00
R4938:Trmo UTSW 4 46382388 missense probably benign 0.00
R4980:Trmo UTSW 4 46389364 nonsense probably null
R5209:Trmo UTSW 4 46387740 missense probably damaging 0.99
R5639:Trmo UTSW 4 46382073 missense probably benign 0.00
R5855:Trmo UTSW 4 46382568 missense probably benign 0.43
R6151:Trmo UTSW 4 46389390 missense probably damaging 1.00
R7351:Trmo UTSW 4 46387716 missense possibly damaging 0.78
R8684:Trmo UTSW 4 46386251 nonsense probably null
R8823:Trmo UTSW 4 46382604 missense probably damaging 1.00
R8856:Trmo UTSW 4 46387625 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGACTTTTCCCGGAGTAAGAC -3'
(R):5'- TCCTACTGTATGCCGGTCATTG -3'

Sequencing Primer
(F):5'- TTTTCCCGGAGTAAGACAAAGAC -3'
(R):5'- TCATTGTGTTGGGTACAAAGAATG -3'
Posted On2021-03-08