Incidental Mutation 'R8684:Herc3'
ID661940
Institutional Source Beutler Lab
Gene Symbol Herc3
Ensembl Gene ENSMUSG00000029804
Gene Namehect domain and RLD 3
Synonyms5730409F18Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8684 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location58831465-58920398 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58887576 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 732 (K732E)
Ref Sequence ENSEMBL: ENSMUSP00000040025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031823] [ENSMUST00000041401] [ENSMUST00000204629]
Predicted Effect probably damaging
Transcript: ENSMUST00000031823
AA Change: K732E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031823
Gene: ENSMUSG00000029804
AA Change: K732E

DomainStartEndE-ValueType
Pfam:RCC1_2 36 65 3.3e-11 PFAM
Pfam:RCC1 52 99 3.6e-15 PFAM
Pfam:RCC1_2 86 115 1.1e-10 PFAM
Pfam:RCC1 102 152 1.4e-16 PFAM
Pfam:RCC1_2 139 168 2.1e-9 PFAM
Pfam:RCC1 155 205 2.6e-16 PFAM
Pfam:RCC1_2 193 221 1.5e-9 PFAM
Pfam:RCC1 208 257 4.7e-17 PFAM
Pfam:RCC1_2 244 273 8e-9 PFAM
Pfam:RCC1 260 309 2.6e-16 PFAM
Pfam:RCC1_2 296 326 2.3e-7 PFAM
Pfam:RCC1 313 377 3.8e-9 PFAM
HECTc 721 913 2.08e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000041401
AA Change: K732E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040025
Gene: ENSMUSG00000029804
AA Change: K732E

DomainStartEndE-ValueType
Pfam:RCC1_2 36 65 1.7e-11 PFAM
Pfam:RCC1 52 99 1.6e-15 PFAM
Pfam:RCC1_2 86 115 1.1e-10 PFAM
Pfam:RCC1 102 152 7.3e-16 PFAM
Pfam:RCC1_2 139 168 1.3e-9 PFAM
Pfam:RCC1 155 205 1.4e-16 PFAM
Pfam:RCC1_2 193 221 5e-10 PFAM
Pfam:RCC1 208 257 1.4e-16 PFAM
Pfam:RCC1_2 244 273 6.1e-8 PFAM
Pfam:RCC1 260 309 1.7e-14 PFAM
Pfam:RCC1_2 296 326 1.1e-7 PFAM
Pfam:RCC1 313 377 6.6e-11 PFAM
HECTc 721 1050 5.79e-157 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204629
SMART Domains Protein: ENSMUSP00000145319
Gene: ENSMUSG00000029804

DomainStartEndE-ValueType
Pfam:HECT 1 97 1.9e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member the HERC ubiquitin ligase family. The encoded protein is located in the cytosol and binds ubiquitin via a HECT domain. Mutations in this gene have been associated with colorectal and gastric carcinomas. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal hair follicle bulge morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933421I07Rik C T 7: 42,447,989 R27H probably benign Het
5430419D17Rik C A 7: 131,235,959 S528* probably null Het
Abca2 T A 2: 25,446,496 L2229Q possibly damaging Het
Adamts4 A T 1: 171,258,972 T778S probably damaging Het
AY358078 T G 14: 51,822,140 Y311* probably null Het
Catsperg1 C T 7: 29,198,400 V181M probably damaging Het
Cep70 A G 9: 99,263,789 K170E possibly damaging Het
Coro1b T A 19: 4,149,528 V62E probably damaging Het
Dnajc11 T C 4: 151,980,726 *560Q probably null Het
Eci3 T C 13: 34,959,891 N84D probably damaging Het
F5 T A 1: 164,217,542 V2133E probably benign Het
Fancl C A 11: 26,470,826 P116Q Het
Gm10801 ATTTTCAGTTTTCTTGCCATATTCCACGTCCTGCACTGGACATTTCTAAATTTTCCACCTTTTTCAGTTTTC ATTTTCAGTTTTC 2: 98,662,324 probably null Het
Golgb1 C T 16: 36,914,402 T1378M possibly damaging Het
Hdac5 T C 11: 102,205,321 N342S probably benign Het
Lce1e A T 3: 92,707,962 I26N unknown Het
Lingo1 T C 9: 56,620,822 Y167C probably damaging Het
Loxl3 A G 6: 83,035,585 E35G probably benign Het
Mmp13 A G 9: 7,282,089 M464V possibly damaging Het
Mov10 T C 3: 104,804,374 H199R probably benign Het
Nbas A G 12: 13,336,367 T765A probably damaging Het
Nlgn3 C T X: 101,319,819 R679* probably null Het
Nrp1 C T 8: 128,359,404 probably benign Het
Nup88 C A 11: 70,969,861 V31L probably benign Het
Olfr1167 T C 2: 88,149,528 T164A probably benign Het
Olfr1352 A T 10: 78,984,378 D196V probably benign Het
Olfr458 T C 6: 42,460,893 N42S probably damaging Het
Pah A G 10: 87,578,965 N393S probably benign Het
Peli3 T C 19: 4,934,994 Y163C probably damaging Het
Rasgef1b A T 5: 99,377,135 M55K probably benign Het
Ror2 T C 13: 53,110,266 D930G possibly damaging Het
Rpgrip1l T G 8: 91,273,701 M537L probably benign Het
Ryr2 A T 13: 11,687,989 V2871E probably damaging Het
Smco1 A T 16: 32,274,023 N171Y probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Sox2 T A 3: 34,650,867 L151Q probably benign Het
Spink5 A G 18: 44,010,238 E754G probably benign Het
Sulf1 A T 1: 12,796,780 M63L probably benign Het
Traf2 A G 2: 25,520,446 M390T probably damaging Het
Trav13d-4 T C 14: 53,072,809 V16A probably damaging Het
Trmo C T 4: 46,386,251 W84* probably null Het
Trmo T C 4: 46,386,253 probably null Het
Ttyh1 T A 7: 4,130,792 probably benign Het
Ush2a A G 1: 188,911,023 N4194S possibly damaging Het
Vmn2r45 T C 7: 8,483,512 Y259C probably damaging Het
Vmn2r94 T A 17: 18,277,650 probably benign Het
Zfp101 A G 17: 33,382,003 S260P possibly damaging Het
Other mutations in Herc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Herc3 APN 6 58874263 missense probably damaging 1.00
IGL00423:Herc3 APN 6 58868715 missense probably damaging 0.99
IGL00468:Herc3 APN 6 58918766 missense probably benign 0.04
IGL01153:Herc3 APN 6 58860336 missense probably benign 0.21
IGL01468:Herc3 APN 6 58854895 missense probably benign 0.00
IGL01696:Herc3 APN 6 58860386 missense possibly damaging 0.58
IGL01975:Herc3 APN 6 58916576 missense possibly damaging 0.91
IGL02797:Herc3 APN 6 58868694 missense probably benign
IGL02953:Herc3 APN 6 58857733 nonsense probably null
aegean UTSW 6 58855760 nonsense probably null
PIT4519001:Herc3 UTSW 6 58876811 missense probably damaging 1.00
R0019:Herc3 UTSW 6 58885065 splice site probably benign
R0019:Herc3 UTSW 6 58885065 splice site probably benign
R0025:Herc3 UTSW 6 58874308 missense probably damaging 1.00
R0025:Herc3 UTSW 6 58874308 missense probably damaging 1.00
R0268:Herc3 UTSW 6 58868628 splice site probably benign
R0334:Herc3 UTSW 6 58918817 missense probably damaging 1.00
R0344:Herc3 UTSW 6 58868628 splice site probably benign
R0853:Herc3 UTSW 6 58876564 missense probably damaging 1.00
R0927:Herc3 UTSW 6 58868763 missense possibly damaging 0.48
R1333:Herc3 UTSW 6 58887493 missense probably damaging 1.00
R1432:Herc3 UTSW 6 58916842 missense possibly damaging 0.49
R1450:Herc3 UTSW 6 58876515 nonsense probably null
R1594:Herc3 UTSW 6 58887584 unclassified probably benign
R1757:Herc3 UTSW 6 58916470 missense probably damaging 1.00
R1765:Herc3 UTSW 6 58888660 missense probably damaging 0.99
R1932:Herc3 UTSW 6 58876793 missense probably damaging 0.99
R1945:Herc3 UTSW 6 58887439 missense probably damaging 0.96
R1988:Herc3 UTSW 6 58884975 critical splice donor site probably null
R2172:Herc3 UTSW 6 58887437 missense probably damaging 1.00
R3080:Herc3 UTSW 6 58856646 splice site probably null
R3545:Herc3 UTSW 6 58856685 missense probably damaging 1.00
R3767:Herc3 UTSW 6 58862988 missense probably benign
R3767:Herc3 UTSW 6 58876602 missense probably benign 0.00
R3805:Herc3 UTSW 6 58916850 missense probably damaging 1.00
R3806:Herc3 UTSW 6 58916850 missense probably damaging 1.00
R4049:Herc3 UTSW 6 58876837 missense probably damaging 0.99
R4250:Herc3 UTSW 6 58916516 missense probably damaging 1.00
R4469:Herc3 UTSW 6 58876809 nonsense probably null
R4534:Herc3 UTSW 6 58860347 missense probably benign
R4573:Herc3 UTSW 6 58894113 missense possibly damaging 0.89
R4887:Herc3 UTSW 6 58887499 missense probably damaging 1.00
R5047:Herc3 UTSW 6 58855760 nonsense probably null
R5049:Herc3 UTSW 6 58894539 splice site probably null
R5062:Herc3 UTSW 6 58855760 nonsense probably null
R5063:Herc3 UTSW 6 58855760 nonsense probably null
R5288:Herc3 UTSW 6 58874278 missense probably damaging 0.99
R5297:Herc3 UTSW 6 58856641 missense probably damaging 1.00
R5386:Herc3 UTSW 6 58874278 missense probably damaging 0.99
R5435:Herc3 UTSW 6 58855806 missense probably damaging 1.00
R5576:Herc3 UTSW 6 58888725 missense probably benign 0.08
R5605:Herc3 UTSW 6 58857727 missense probably damaging 1.00
R5719:Herc3 UTSW 6 58894543 missense possibly damaging 0.67
R5743:Herc3 UTSW 6 58918799 missense probably benign 0.12
R5870:Herc3 UTSW 6 58916450 missense probably benign 0.01
R6460:Herc3 UTSW 6 58890123 missense probably damaging 1.00
R6930:Herc3 UTSW 6 58916459 missense probably damaging 0.98
R7034:Herc3 UTSW 6 58876855 missense probably benign 0.00
R7131:Herc3 UTSW 6 58887424 missense probably damaging 1.00
R7187:Herc3 UTSW 6 58856631 missense probably benign 0.42
R7212:Herc3 UTSW 6 58918773 missense probably damaging 1.00
R7335:Herc3 UTSW 6 58876788 missense possibly damaging 0.95
R7349:Herc3 UTSW 6 58858986 missense probably benign
R7568:Herc3 UTSW 6 58843810 missense probably benign 0.01
R7857:Herc3 UTSW 6 58843652 nonsense probably null
R8321:Herc3 UTSW 6 58843769 missense possibly damaging 0.93
R8672:Herc3 UTSW 6 58873801 missense probably damaging 0.96
Z1176:Herc3 UTSW 6 58843858 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAGGTGGCAGTCAATGGAGC -3'
(R):5'- TACAATGAGATGCTCTTTCTGGTG -3'

Sequencing Primer
(F):5'- GCCAACCTGCAGAATGTCTTCATG -3'
(R):5'- CTCTTTCTGGTGACTGCACAAAAGG -3'
Posted On2021-03-08