Incidental Mutation 'R8684:Vmn2r45'
ID661942
Institutional Source Beutler Lab
Gene Symbol Vmn2r45
Ensembl Gene ENSMUSG00000090662
Gene Namevomeronasal 2, receptor 45
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R8684 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location8470525-8489075 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8483512 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 259 (Y259C)
Ref Sequence ENSEMBL: ENSMUSP00000129466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164845]
Predicted Effect probably damaging
Transcript: ENSMUST00000164845
AA Change: Y259C

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129466
Gene: ENSMUSG00000090662
AA Change: Y259C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 154 469 4.5e-26 PFAM
Pfam:NCD3G 512 565 6.4e-21 PFAM
Pfam:7tm_3 598 833 2.1e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933421I07Rik C T 7: 42,447,989 R27H probably benign Het
5430419D17Rik C A 7: 131,235,959 S528* probably null Het
Abca2 T A 2: 25,446,496 L2229Q possibly damaging Het
Adamts4 A T 1: 171,258,972 T778S probably damaging Het
AY358078 T G 14: 51,822,140 Y311* probably null Het
Catsperg1 C T 7: 29,198,400 V181M probably damaging Het
Cep70 A G 9: 99,263,789 K170E possibly damaging Het
Coro1b T A 19: 4,149,528 V62E probably damaging Het
Dnajc11 T C 4: 151,980,726 *560Q probably null Het
Eci3 T C 13: 34,959,891 N84D probably damaging Het
F5 T A 1: 164,217,542 V2133E probably benign Het
Fancl C A 11: 26,470,826 P116Q Het
Gm10801 ATTTTCAGTTTTCTTGCCATATTCCACGTCCTGCACTGGACATTTCTAAATTTTCCACCTTTTTCAGTTTTC ATTTTCAGTTTTC 2: 98,662,324 probably null Het
Golgb1 C T 16: 36,914,402 T1378M possibly damaging Het
Hdac5 T C 11: 102,205,321 N342S probably benign Het
Herc3 A G 6: 58,887,576 K732E probably damaging Het
Lce1e A T 3: 92,707,962 I26N unknown Het
Lingo1 T C 9: 56,620,822 Y167C probably damaging Het
Loxl3 A G 6: 83,035,585 E35G probably benign Het
Mmp13 A G 9: 7,282,089 M464V possibly damaging Het
Mov10 T C 3: 104,804,374 H199R probably benign Het
Nbas A G 12: 13,336,367 T765A probably damaging Het
Nlgn3 C T X: 101,319,819 R679* probably null Het
Nrp1 C T 8: 128,359,404 probably benign Het
Nup88 C A 11: 70,969,861 V31L probably benign Het
Olfr1167 T C 2: 88,149,528 T164A probably benign Het
Olfr1352 A T 10: 78,984,378 D196V probably benign Het
Olfr458 T C 6: 42,460,893 N42S probably damaging Het
Pah A G 10: 87,578,965 N393S probably benign Het
Peli3 T C 19: 4,934,994 Y163C probably damaging Het
Rasgef1b A T 5: 99,377,135 M55K probably benign Het
Ror2 T C 13: 53,110,266 D930G possibly damaging Het
Rpgrip1l T G 8: 91,273,701 M537L probably benign Het
Ryr2 A T 13: 11,687,989 V2871E probably damaging Het
Smco1 A T 16: 32,274,023 N171Y probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Sox2 T A 3: 34,650,867 L151Q probably benign Het
Spink5 A G 18: 44,010,238 E754G probably benign Het
Sulf1 A T 1: 12,796,780 M63L probably benign Het
Traf2 A G 2: 25,520,446 M390T probably damaging Het
Trav13d-4 T C 14: 53,072,809 V16A probably damaging Het
Trmo C T 4: 46,386,251 W84* probably null Het
Trmo T C 4: 46,386,253 probably null Het
Ttyh1 T A 7: 4,130,792 probably benign Het
Ush2a A G 1: 188,911,023 N4194S possibly damaging Het
Vmn2r94 T A 17: 18,277,650 probably benign Het
Zfp101 A G 17: 33,382,003 S260P possibly damaging Het
Other mutations in Vmn2r45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Vmn2r45 APN 7 8485623 missense probably benign 0.00
IGL01322:Vmn2r45 APN 7 8481333 missense possibly damaging 0.49
IGL01402:Vmn2r45 APN 7 8481468 missense probably damaging 0.98
IGL01404:Vmn2r45 APN 7 8481468 missense probably damaging 0.98
IGL01529:Vmn2r45 APN 7 8483494 missense probably benign
IGL01596:Vmn2r45 APN 7 8483273 missense probably damaging 0.98
IGL01646:Vmn2r45 APN 7 8483338 missense probably benign 0.18
IGL01819:Vmn2r45 APN 7 8485557 missense probably benign 0.00
IGL02096:Vmn2r45 APN 7 8481444 missense probably damaging 0.99
IGL02130:Vmn2r45 APN 7 8483557 missense possibly damaging 0.46
IGL02409:Vmn2r45 APN 7 8485728 missense probably benign 0.03
IGL02517:Vmn2r45 APN 7 8483186 nonsense probably null
IGL02633:Vmn2r45 APN 7 8485729 missense probably benign 0.01
IGL02940:Vmn2r45 APN 7 8472370 missense probably damaging 0.99
IGL03281:Vmn2r45 APN 7 8483604 missense probably damaging 1.00
IGL03358:Vmn2r45 APN 7 8471716 missense probably damaging 1.00
BB004:Vmn2r45 UTSW 7 8483514 missense probably benign
BB014:Vmn2r45 UTSW 7 8483514 missense probably benign
R0382:Vmn2r45 UTSW 7 8483099 missense probably benign 0.06
R0532:Vmn2r45 UTSW 7 8471821 missense probably damaging 0.99
R0932:Vmn2r45 UTSW 7 8475381 missense probably damaging 1.00
R1125:Vmn2r45 UTSW 7 8485543 missense probably benign 0.00
R1580:Vmn2r45 UTSW 7 8471747 missense possibly damaging 0.95
R1817:Vmn2r45 UTSW 7 8472373 missense probably damaging 1.00
R1996:Vmn2r45 UTSW 7 8472025 missense probably damaging 1.00
R2050:Vmn2r45 UTSW 7 8472022 missense probably damaging 1.00
R2284:Vmn2r45 UTSW 7 8485766 missense probably benign 0.02
R4019:Vmn2r45 UTSW 7 8471581 nonsense probably null
R4227:Vmn2r45 UTSW 7 8483278 missense probably damaging 0.98
R4381:Vmn2r45 UTSW 7 8471913 nonsense probably null
R4618:Vmn2r45 UTSW 7 8483437 missense probably benign 0.00
R4624:Vmn2r45 UTSW 7 8481342 missense probably damaging 1.00
R4704:Vmn2r45 UTSW 7 8483536 nonsense probably null
R4735:Vmn2r45 UTSW 7 8483473 missense probably damaging 1.00
R4868:Vmn2r45 UTSW 7 8481481 missense probably benign 0.06
R4983:Vmn2r45 UTSW 7 8483117 missense probably damaging 0.99
R5246:Vmn2r45 UTSW 7 8483252 missense probably benign 0.00
R5430:Vmn2r45 UTSW 7 8483334 nonsense probably null
R5504:Vmn2r45 UTSW 7 8483177 missense probably benign 0.03
R5511:Vmn2r45 UTSW 7 8471833 missense probably benign 0.19
R5745:Vmn2r45 UTSW 7 8483075 missense probably benign 0.00
R5814:Vmn2r45 UTSW 7 8471476 missense probably benign 0.00
R6223:Vmn2r45 UTSW 7 8483302 missense probably benign
R6267:Vmn2r45 UTSW 7 8472208 missense probably benign 0.26
R6623:Vmn2r45 UTSW 7 8471501 missense probably benign 0.09
R6999:Vmn2r45 UTSW 7 8483220 missense probably benign
R7242:Vmn2r45 UTSW 7 8485613 nonsense probably null
R7491:Vmn2r45 UTSW 7 8481343 missense probably benign 0.27
R7620:Vmn2r45 UTSW 7 8483223 nonsense probably null
R7719:Vmn2r45 UTSW 7 8483461 missense probably damaging 0.99
R7720:Vmn2r45 UTSW 7 8483461 missense probably damaging 0.99
R7853:Vmn2r45 UTSW 7 8482988 missense possibly damaging 0.90
R7873:Vmn2r45 UTSW 7 8483075 missense probably benign 0.00
R7882:Vmn2r45 UTSW 7 8483410 missense possibly damaging 0.82
R7927:Vmn2r45 UTSW 7 8483514 missense probably benign
R8780:Vmn2r45 UTSW 7 8481372 missense possibly damaging 0.94
R8811:Vmn2r45 UTSW 7 8471882 missense probably damaging 1.00
R8893:Vmn2r45 UTSW 7 8485620 missense probably damaging 1.00
U24488:Vmn2r45 UTSW 7 8472362 missense probably damaging 1.00
Z1088:Vmn2r45 UTSW 7 8471485 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GAATGTGCCATGACTTATGTCTGTC -3'
(R):5'- TCTCTATCAGATGGCCCCAAAG -3'

Sequencing Primer
(F):5'- CTTCCTGGTAGGGAAATTCAATTG -3'
(R):5'- GGACACATCTCTAGCATTGGCAATG -3'
Posted On2021-03-08