Incidental Mutation 'R8684:Olfr1352'
ID661951
Institutional Source Beutler Lab
Gene Symbol Olfr1352
Ensembl Gene ENSMUSG00000046493
Gene Nameolfactory receptor 1352
SynonymsMOR139-1, GA_x6K02T2QGN0-2828447-2827518
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R8684 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location78981050-78987903 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 78984378 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 196 (D196V)
Ref Sequence ENSEMBL: ENSMUSP00000054355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058991] [ENSMUST00000203973]
Predicted Effect probably benign
Transcript: ENSMUST00000058991
AA Change: D196V

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000054355
Gene: ENSMUSG00000046493
AA Change: D196V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.7e-52 PFAM
Pfam:7TM_GPCR_Srsx 35 305 9.1e-6 PFAM
Pfam:7tm_1 41 290 4.7e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203973
SMART Domains Protein: ENSMUSP00000144895
Gene: ENSMUSG00000046493

DomainStartEndE-ValueType
Pfam:7tm_4 1 122 6.1e-25 PFAM
Pfam:7TM_GPCR_Srx 1 123 7.5e-5 PFAM
Pfam:7TM_GPCR_Srsx 2 123 4.5e-8 PFAM
Pfam:7tm_1 8 123 2.1e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933421I07Rik C T 7: 42,447,989 R27H probably benign Het
5430419D17Rik C A 7: 131,235,959 S528* probably null Het
Abca2 T A 2: 25,446,496 L2229Q possibly damaging Het
Adamts4 A T 1: 171,258,972 T778S probably damaging Het
AY358078 T G 14: 51,822,140 Y311* probably null Het
Catsperg1 C T 7: 29,198,400 V181M probably damaging Het
Cep70 A G 9: 99,263,789 K170E possibly damaging Het
Coro1b T A 19: 4,149,528 V62E probably damaging Het
Dnajc11 T C 4: 151,980,726 *560Q probably null Het
Eci3 T C 13: 34,959,891 N84D probably damaging Het
F5 T A 1: 164,217,542 V2133E probably benign Het
Fancl C A 11: 26,470,826 P116Q Het
Gm10801 ATTTTCAGTTTTCTTGCCATATTCCACGTCCTGCACTGGACATTTCTAAATTTTCCACCTTTTTCAGTTTTC ATTTTCAGTTTTC 2: 98,662,324 probably null Het
Golgb1 C T 16: 36,914,402 T1378M possibly damaging Het
Hdac5 T C 11: 102,205,321 N342S probably benign Het
Herc3 A G 6: 58,887,576 K732E probably damaging Het
Lce1e A T 3: 92,707,962 I26N unknown Het
Lingo1 T C 9: 56,620,822 Y167C probably damaging Het
Loxl3 A G 6: 83,035,585 E35G probably benign Het
Mmp13 A G 9: 7,282,089 M464V possibly damaging Het
Mov10 T C 3: 104,804,374 H199R probably benign Het
Nbas A G 12: 13,336,367 T765A probably damaging Het
Nlgn3 C T X: 101,319,819 R679* probably null Het
Nrp1 C T 8: 128,359,404 probably benign Het
Nup88 C A 11: 70,969,861 V31L probably benign Het
Olfr1167 T C 2: 88,149,528 T164A probably benign Het
Olfr458 T C 6: 42,460,893 N42S probably damaging Het
Pah A G 10: 87,578,965 N393S probably benign Het
Peli3 T C 19: 4,934,994 Y163C probably damaging Het
Rasgef1b A T 5: 99,377,135 M55K probably benign Het
Ror2 T C 13: 53,110,266 D930G possibly damaging Het
Rpgrip1l T G 8: 91,273,701 M537L probably benign Het
Ryr2 A T 13: 11,687,989 V2871E probably damaging Het
Smco1 A T 16: 32,274,023 N171Y probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Sox2 T A 3: 34,650,867 L151Q probably benign Het
Spink5 A G 18: 44,010,238 E754G probably benign Het
Sulf1 A T 1: 12,796,780 M63L probably benign Het
Traf2 A G 2: 25,520,446 M390T probably damaging Het
Trav13d-4 T C 14: 53,072,809 V16A probably damaging Het
Trmo C T 4: 46,386,251 W84* probably null Het
Trmo T C 4: 46,386,253 probably null Het
Ttyh1 T A 7: 4,130,792 probably benign Het
Ush2a A G 1: 188,911,023 N4194S possibly damaging Het
Vmn2r45 T C 7: 8,483,512 Y259C probably damaging Het
Vmn2r94 T A 17: 18,277,650 probably benign Het
Zfp101 A G 17: 33,382,003 S260P possibly damaging Het
Other mutations in Olfr1352
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01468:Olfr1352 APN 10 78983862 missense probably damaging 0.96
IGL01865:Olfr1352 APN 10 78984678 missense possibly damaging 0.94
R0196:Olfr1352 UTSW 10 78984189 missense possibly damaging 0.89
R0362:Olfr1352 UTSW 10 78984386 missense probably benign 0.00
R1574:Olfr1352 UTSW 10 78983986 missense probably damaging 1.00
R1574:Olfr1352 UTSW 10 78983986 missense probably damaging 1.00
R2982:Olfr1352 UTSW 10 78984440 missense probably damaging 1.00
R4724:Olfr1352 UTSW 10 78984522 missense probably damaging 1.00
R5000:Olfr1352 UTSW 10 78984680 missense probably benign 0.00
R5085:Olfr1352 UTSW 10 78984094 missense probably benign 0.03
R5145:Olfr1352 UTSW 10 78984309 missense probably benign 0.35
R5455:Olfr1352 UTSW 10 78984537 missense possibly damaging 0.59
R5777:Olfr1352 UTSW 10 78984678 missense possibly damaging 0.78
R5822:Olfr1352 UTSW 10 78984189 missense possibly damaging 0.89
R6283:Olfr1352 UTSW 10 78984279 missense probably benign 0.01
R7242:Olfr1352 UTSW 10 78984497 nonsense probably null
R7504:Olfr1352 UTSW 10 78984660 missense possibly damaging 0.78
R8198:Olfr1352 UTSW 10 78984609 missense probably benign 0.03
R8268:Olfr1352 UTSW 10 78983997 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATGAATCGCAGACTCTGTGG -3'
(R):5'- ACAGAGGCTGTTGCACTTG -3'

Sequencing Primer
(F):5'- AATCGCAGACTCTGTGGATTTTTG -3'
(R):5'- CTGAGGTATACTCCTAGACCAGTG -3'
Posted On2021-03-08