Incidental Mutation 'R8684:Fancl'
ID661953
Institutional Source Beutler Lab
Gene Symbol Fancl
Ensembl Gene ENSMUSG00000004018
Gene NameFanconi anemia, complementation group L
SynonymsB230118H11Rik, 2010322C19Rik, Phf9, Pog, gcd
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.924) question?
Stock #R8684 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location26386135-26471876 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 26470826 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 116 (P116Q)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004120] [ENSMUST00000078362] [ENSMUST00000109504] [ENSMUST00000109509]
Predicted Effect probably benign
Transcript: ENSMUST00000004120
SMART Domains Protein: ENSMUSP00000004120
Gene: ENSMUSG00000004018

DomainStartEndE-ValueType
Pfam:WD-3 11 295 1.1e-106 PFAM
FANCL_C 303 371 7.55e-44 SMART
RING 307 362 2.77e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000078362
SMART Domains Protein: ENSMUSP00000077471
Gene: ENSMUSG00000064090

DomainStartEndE-ValueType
Pfam:Pkinase 29 298 4.4e-18 PFAM
Pfam:Pkinase_Tyr 29 313 2e-11 PFAM
low complexity region 365 376 N/A INTRINSIC
transmembrane domain 480 502 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109504
SMART Domains Protein: ENSMUSP00000105130
Gene: ENSMUSG00000064090

DomainStartEndE-ValueType
Pfam:Pkinase 29 302 2.8e-22 PFAM
Pfam:Pkinase_Tyr 29 313 1.3e-11 PFAM
low complexity region 365 376 N/A INTRINSIC
transmembrane domain 480 502 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109509
SMART Domains Protein: ENSMUSP00000105135
Gene: ENSMUSG00000004018

DomainStartEndE-ValueType
Pfam:WD-3 8 290 2.4e-116 PFAM
FANCL_C 298 366 7.55e-44 SMART
RING 302 357 2.77e-1 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000119873
Gene: ENSMUSG00000004018
AA Change: P116Q

DomainStartEndE-ValueType
Pfam:WD-3 1 65 2.2e-24 PFAM
Pfam:FANCL_C 73 127 4.2e-19 PFAM
Meta Mutation Damage Score 0.0852 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: This gene encodes the complementation group L subunit of the multimeric Fanconi anemia (FA) nuclear complex composed of proteins encoded by over ten Fanconi anemia complementation (FANC) group genes. The FA complex is necessary for protection against DNA damage. This gene product, an E3 ubiquitin ligase, catalyzes and is required for the monoubiquitination of the protein encoded by the Fanconi anemia, complementation group D2 gene, a critical step in the FA pathway (PMID: 12973351, 21229326). In mouse, mutations of this E3 ubiquitin ligase gene can lead to infertility in adult males and females, and a deletion of this gene can cause embryonic lethality in some genetic backgrounds. A pseudogene of this gene has been identified on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygosity for mutations that inactivate the allele results in male and female infertility due to a defects in primordial germ cell proliferation. Homozygosity is embryonic lethal on some backgrounds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933421I07Rik C T 7: 42,447,989 R27H probably benign Het
5430419D17Rik C A 7: 131,235,959 S528* probably null Het
Abca2 T A 2: 25,446,496 L2229Q possibly damaging Het
Adamts4 A T 1: 171,258,972 T778S probably damaging Het
AY358078 T G 14: 51,822,140 Y311* probably null Het
Catsperg1 C T 7: 29,198,400 V181M probably damaging Het
Cep70 A G 9: 99,263,789 K170E possibly damaging Het
Coro1b T A 19: 4,149,528 V62E probably damaging Het
Dnajc11 T C 4: 151,980,726 *560Q probably null Het
Eci3 T C 13: 34,959,891 N84D probably damaging Het
F5 T A 1: 164,217,542 V2133E probably benign Het
Gm10801 ATTTTCAGTTTTCTTGCCATATTCCACGTCCTGCACTGGACATTTCTAAATTTTCCACCTTTTTCAGTTTTC ATTTTCAGTTTTC 2: 98,662,324 probably null Het
Golgb1 C T 16: 36,914,402 T1378M possibly damaging Het
Hdac5 T C 11: 102,205,321 N342S probably benign Het
Herc3 A G 6: 58,887,576 K732E probably damaging Het
Lce1e A T 3: 92,707,962 I26N unknown Het
Lingo1 T C 9: 56,620,822 Y167C probably damaging Het
Loxl3 A G 6: 83,035,585 E35G probably benign Het
Mmp13 A G 9: 7,282,089 M464V possibly damaging Het
Mov10 T C 3: 104,804,374 H199R probably benign Het
Nbas A G 12: 13,336,367 T765A probably damaging Het
Nlgn3 C T X: 101,319,819 R679* probably null Het
Nrp1 C T 8: 128,359,404 probably benign Het
Nup88 C A 11: 70,969,861 V31L probably benign Het
Olfr1167 T C 2: 88,149,528 T164A probably benign Het
Olfr1352 A T 10: 78,984,378 D196V probably benign Het
Olfr458 T C 6: 42,460,893 N42S probably damaging Het
Pah A G 10: 87,578,965 N393S probably benign Het
Peli3 T C 19: 4,934,994 Y163C probably damaging Het
Rasgef1b A T 5: 99,377,135 M55K probably benign Het
Ror2 T C 13: 53,110,266 D930G possibly damaging Het
Rpgrip1l T G 8: 91,273,701 M537L probably benign Het
Ryr2 A T 13: 11,687,989 V2871E probably damaging Het
Smco1 A T 16: 32,274,023 N171Y probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Sox2 T A 3: 34,650,867 L151Q probably benign Het
Spink5 A G 18: 44,010,238 E754G probably benign Het
Sulf1 A T 1: 12,796,780 M63L probably benign Het
Traf2 A G 2: 25,520,446 M390T probably damaging Het
Trav13d-4 T C 14: 53,072,809 V16A probably damaging Het
Trmo C T 4: 46,386,251 W84* probably null Het
Trmo T C 4: 46,386,253 probably null Het
Ttyh1 T A 7: 4,130,792 probably benign Het
Ush2a A G 1: 188,911,023 N4194S possibly damaging Het
Vmn2r45 T C 7: 8,483,512 Y259C probably damaging Het
Vmn2r94 T A 17: 18,277,650 probably benign Het
Zfp101 A G 17: 33,382,003 S260P possibly damaging Het
Other mutations in Fancl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00755:Fancl APN 11 26470916 missense probably benign
IGL01940:Fancl APN 11 26459752 missense probably damaging 0.99
IGL02681:Fancl APN 11 26468722 splice site probably null
IGL03063:Fancl APN 11 26387299 missense probably damaging 1.00
R0006:Fancl UTSW 11 26469695 missense possibly damaging 0.46
R0006:Fancl UTSW 11 26469695 missense possibly damaging 0.46
R0218:Fancl UTSW 11 26471337 missense probably benign 0.30
R1016:Fancl UTSW 11 26387195 unclassified probably benign
R1802:Fancl UTSW 11 26459709 missense probably benign 0.01
R2018:Fancl UTSW 11 26422459 missense probably damaging 1.00
R2121:Fancl UTSW 11 26459841 splice site probably benign
R4579:Fancl UTSW 11 26468423 splice site probably null
R5472:Fancl UTSW 11 26469677 missense probably damaging 1.00
R5495:Fancl UTSW 11 26397801 missense probably damaging 1.00
R6425:Fancl UTSW 11 26399680 missense probably damaging 1.00
R7114:Fancl UTSW 11 26407615 missense probably damaging 1.00
R7139:Fancl UTSW 11 26403358 missense probably benign 0.01
R7302:Fancl UTSW 11 26403363 missense probably damaging 0.98
R7324:Fancl UTSW 11 26403362 missense probably damaging 1.00
R8307:Fancl UTSW 11 26399642 splice site probably benign
R8732:Fancl UTSW 11 26469754 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACAACAACTTGTATGCGTCTCTC -3'
(R):5'- GAGCCAGGCACACTTTACAAG -3'

Sequencing Primer
(F):5'- ATGCGTCTCTCTCTGTGTAAG -3'
(R):5'- GCCAGGCACACTTTACAAGATATGTG -3'
Posted On2021-03-08