Incidental Mutation 'R8684:Ror2'
ID 661959
Institutional Source Beutler Lab
Gene Symbol Ror2
Ensembl Gene ENSMUSG00000021464
Gene Name receptor tyrosine kinase-like orphan receptor 2
Synonyms Ntrkr2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8684 (G1)
Quality Score 198.009
Status Validated
Chromosome 13
Chromosomal Location 53109312-53286124 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 53110266 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 930 (D930G)
Ref Sequence ENSEMBL: ENSMUSP00000021918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021918] [ENSMUST00000130235]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000021918
AA Change: D930G

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021918
Gene: ENSMUSG00000021464
AA Change: D930G

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
IGc2 74 142 5.23e-16 SMART
Pfam:Fz 174 294 1.2e-12 PFAM
KR 314 396 3.94e-45 SMART
transmembrane domain 403 425 N/A INTRINSIC
TyrKc 473 746 1.96e-113 SMART
low complexity region 765 783 N/A INTRINSIC
low complexity region 788 801 N/A INTRINSIC
low complexity region 839 859 N/A INTRINSIC
low complexity region 860 872 N/A INTRINSIC
low complexity region 905 924 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000130235
AA Change: D918G

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123362
Gene: ENSMUSG00000021464
AA Change: D918G

DomainStartEndE-ValueType
IGc2 62 130 5.23e-16 SMART
Pfam:Fz 162 289 3.2e-26 PFAM
KR 302 384 3.94e-45 SMART
transmembrane domain 391 413 N/A INTRINSIC
TyrKc 461 734 1.96e-113 SMART
low complexity region 753 771 N/A INTRINSIC
low complexity region 776 789 N/A INTRINSIC
low complexity region 827 847 N/A INTRINSIC
low complexity region 848 860 N/A INTRINSIC
low complexity region 893 912 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor protein tyrosine kinase and type I transmembrane protein that belongs to the ROR subfamily of cell surface receptors. The protein may be involved in the early formation of the chondrocytes and may be required for cartilage and growth plate development. Mutations in this gene can cause brachydactyly type B, a skeletal disorder characterized by hypoplasia/aplasia of distal phalanges and nails. In addition, mutations in this gene can cause the autosomal recessive form of Robinow syndrome, which is characterized by skeletal dysplasia with generalized limb bone shortening, segmental defects of the spine, brachydactyly, and a dysmorphic facial appearance. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some disruptions in this gene die within the first few hours after birth. They display respiratory and cardiovascular abnormalities as well as a variety of skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933421I07Rik C T 7: 42,447,989 R27H probably benign Het
5430419D17Rik C A 7: 131,235,959 S528* probably null Het
Abca2 T A 2: 25,446,496 L2229Q possibly damaging Het
Adamts4 A T 1: 171,258,972 T778S probably damaging Het
AY358078 T G 14: 51,822,140 Y311* probably null Het
Catsperg1 C T 7: 29,198,400 V181M probably damaging Het
Cep70 A G 9: 99,263,789 K170E possibly damaging Het
Coro1b T A 19: 4,149,528 V62E probably damaging Het
Dnajc11 T C 4: 151,980,726 *560Q probably null Het
Eci3 T C 13: 34,959,891 N84D probably damaging Het
F5 T A 1: 164,217,542 V2133E probably benign Het
Fancl C A 11: 26,470,826 P116Q Het
Gm10801 ATTTTCAGTTTTCTTGCCATATTCCACGTCCTGCACTGGACATTTCTAAATTTTCCACCTTTTTCAGTTTTC ATTTTCAGTTTTC 2: 98,662,324 probably null Het
Golgb1 C T 16: 36,914,402 T1378M possibly damaging Het
Hdac5 T C 11: 102,205,321 N342S probably benign Het
Herc3 A G 6: 58,887,576 K732E probably damaging Het
Lce1e A T 3: 92,707,962 I26N unknown Het
Lingo1 T C 9: 56,620,822 Y167C probably damaging Het
Loxl3 A G 6: 83,035,585 E35G probably benign Het
Mmp13 A G 9: 7,282,089 M464V possibly damaging Het
Mov10 T C 3: 104,804,374 H199R probably benign Het
Nbas A G 12: 13,336,367 T765A probably damaging Het
Nlgn3 C T X: 101,319,819 R679* probably null Het
Nrp1 C T 8: 128,359,404 probably benign Het
Nup88 C A 11: 70,969,861 V31L probably benign Het
Olfr1167 T C 2: 88,149,528 T164A probably benign Het
Olfr1352 A T 10: 78,984,378 D196V probably benign Het
Olfr458 T C 6: 42,460,893 N42S probably damaging Het
Pah A G 10: 87,578,965 N393S probably benign Het
Peli3 T C 19: 4,934,994 Y163C probably damaging Het
Rasgef1b A T 5: 99,377,135 M55K probably benign Het
Rpgrip1l T G 8: 91,273,701 M537L probably benign Het
Ryr2 A T 13: 11,687,989 V2871E probably damaging Het
Smco1 A T 16: 32,274,023 N171Y probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Sox2 T A 3: 34,650,867 L151Q probably benign Het
Spink5 A G 18: 44,010,238 E754G probably benign Het
Sulf1 A T 1: 12,796,780 M63L probably benign Het
Traf2 A G 2: 25,520,446 M390T probably damaging Het
Trav13d-4 T C 14: 53,072,809 V16A probably damaging Het
Trmo C T 4: 46,386,251 W84* probably null Het
Trmo T C 4: 46,386,253 probably null Het
Ttyh1 T A 7: 4,130,792 probably benign Het
Ush2a A G 1: 188,911,023 N4194S possibly damaging Het
Vmn2r45 T C 7: 8,483,512 Y259C probably damaging Het
Vmn2r94 T A 17: 18,277,650 probably benign Het
Zfp101 A G 17: 33,382,003 S260P possibly damaging Het
Other mutations in Ror2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Ror2 APN 13 53113082 missense probably benign 0.01
IGL01523:Ror2 APN 13 53118963 missense probably benign 0.02
IGL01599:Ror2 APN 13 53111617 missense probably damaging 1.00
IGL01669:Ror2 APN 13 53111088 missense probably damaging 1.00
IGL02016:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02138:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02139:Ror2 APN 13 53111164 missense probably damaging 1.00
IGL02172:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02173:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02176:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02177:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02178:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02179:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02182:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02189:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02190:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02203:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02230:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02231:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02234:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02423:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02424:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02478:Ror2 APN 13 53121667 missense probably damaging 1.00
IGL02479:Ror2 APN 13 53131932 missense possibly damaging 0.62
IGL02517:Ror2 APN 13 53118840 missense probably damaging 1.00
IGL02554:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02618:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02619:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02622:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02623:Ror2 APN 13 53110728 missense probably damaging 1.00
lavage UTSW 13 53118982 missense probably damaging 1.00
tendrils UTSW 13 53111451 missense probably damaging 0.96
willowy UTSW 13 53131919 missense probably damaging 1.00
R0076:Ror2 UTSW 13 53113074 missense probably benign 0.02
R0375:Ror2 UTSW 13 53132004 missense probably damaging 1.00
R0826:Ror2 UTSW 13 53113217 missense probably damaging 1.00
R1823:Ror2 UTSW 13 53110305 missense probably benign 0.07
R1895:Ror2 UTSW 13 53131849 missense probably damaging 1.00
R1946:Ror2 UTSW 13 53131849 missense probably damaging 1.00
R1983:Ror2 UTSW 13 53110408 missense probably benign 0.01
R2031:Ror2 UTSW 13 53117330 missense probably benign 0.01
R2197:Ror2 UTSW 13 53285780 critical splice donor site probably null
R2246:Ror2 UTSW 13 53111602 missense probably damaging 1.00
R2405:Ror2 UTSW 13 53130944 missense possibly damaging 0.67
R2411:Ror2 UTSW 13 53130944 missense possibly damaging 0.67
R2905:Ror2 UTSW 13 53131995 missense probably benign 0.01
R3156:Ror2 UTSW 13 53117364 missense probably damaging 0.98
R4198:Ror2 UTSW 13 53110644 missense probably benign 0.08
R4408:Ror2 UTSW 13 53118961 missense probably damaging 1.00
R4469:Ror2 UTSW 13 53131980 missense possibly damaging 0.87
R4648:Ror2 UTSW 13 53285500 nonsense probably null
R4705:Ror2 UTSW 13 53117297 missense probably benign 0.00
R4824:Ror2 UTSW 13 53110683 missense probably benign 0.10
R4831:Ror2 UTSW 13 53118844 missense probably damaging 0.97
R4951:Ror2 UTSW 13 53117147 missense probably benign 0.00
R4975:Ror2 UTSW 13 53131918 missense probably damaging 1.00
R5380:Ror2 UTSW 13 53117149 missense possibly damaging 0.73
R5469:Ror2 UTSW 13 53117339 missense probably benign 0.00
R5604:Ror2 UTSW 13 53117165 missense probably benign 0.01
R6188:Ror2 UTSW 13 53111311 missense probably damaging 0.98
R6221:Ror2 UTSW 13 53113217 missense probably damaging 1.00
R6243:Ror2 UTSW 13 53113080 missense probably benign
R6255:Ror2 UTSW 13 53110542 missense probably damaging 1.00
R6497:Ror2 UTSW 13 53131919 missense probably damaging 1.00
R6717:Ror2 UTSW 13 53118982 missense probably damaging 1.00
R6918:Ror2 UTSW 13 53111451 missense probably damaging 0.96
R7092:Ror2 UTSW 13 53110236 missense probably benign
R7134:Ror2 UTSW 13 53146706 missense probably benign 0.00
R7254:Ror2 UTSW 13 53118720 missense possibly damaging 0.72
R7517:Ror2 UTSW 13 53110865 missense possibly damaging 0.86
R7560:Ror2 UTSW 13 53110813 missense probably benign 0.05
R7746:Ror2 UTSW 13 53117225 missense probably damaging 1.00
R8031:Ror2 UTSW 13 53113157 missense probably damaging 1.00
R8479:Ror2 UTSW 13 53117364 missense probably damaging 0.98
R8834:Ror2 UTSW 13 53110302 small deletion probably benign
R8948:Ror2 UTSW 13 53131996 missense possibly damaging 0.67
R9233:Ror2 UTSW 13 53111554 missense probably benign
R9234:Ror2 UTSW 13 53111338 missense probably damaging 1.00
R9573:Ror2 UTSW 13 53111431 missense not run
Predicted Primers PCR Primer
(F):5'- TCTCAGGTGGGTAGGCTCAAAC -3'
(R):5'- AGTCCAGATCCCCATGCAGATG -3'

Sequencing Primer
(F):5'- TCAAACCAGCCTGCCAGTC -3'
(R):5'- ATGCAGATGGCCCCACAG -3'
Posted On 2021-03-08