Incidental Mutation 'R8685:Adgrl3'
ID 661980
Institutional Source Beutler Lab
Gene Symbol Adgrl3
Ensembl Gene ENSMUSG00000037605
Gene Name adhesion G protein-coupled receptor L3
Synonyms lectomedin 3, D130075K09Rik, 5430402I23Rik, Lphn3, LEC3
MMRRC Submission 068540-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8685 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 81167985-81972980 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 81874708 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 1002 (D1002Y)
Ref Sequence ENSEMBL: ENSMUSP00000112470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036068] [ENSMUST00000072521] [ENSMUST00000117253] [ENSMUST00000117407] [ENSMUST00000117985] [ENSMUST00000118034] [ENSMUST00000118078] [ENSMUST00000118442] [ENSMUST00000119385] [ENSMUST00000119788] [ENSMUST00000120128] [ENSMUST00000120144] [ENSMUST00000120292] [ENSMUST00000120445] [ENSMUST00000120673] [ENSMUST00000121641] [ENSMUST00000121707] [ENSMUST00000122037] [ENSMUST00000122356] [ENSMUST00000132375]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000036068
AA Change: D1070Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045342
Gene: ENSMUSG00000037605
AA Change: D1070Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 6.6e-27 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 1.1e-7 PFAM
Pfam:DUF3497 627 857 2.2e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1187 4.4e-72 PFAM
Pfam:Latrophilin 1206 1276 2.4e-30 PFAM
Pfam:Latrophilin 1272 1543 3.2e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072521
AA Change: D1070Y

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000072336
Gene: ENSMUSG00000037605
AA Change: D1070Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 5.9e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 4.3e-8 PFAM
Pfam:GAIN 630 856 1.2e-58 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1187 2.5e-73 PFAM
Pfam:Latrophilin 1207 1274 4e-34 PFAM
Pfam:Latrophilin 1272 1543 5e-89 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000117253
AA Change: D1002Y

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112470
Gene: ENSMUSG00000037605
AA Change: D1002Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 1e-26 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 4.5e-8 PFAM
Pfam:DUF3497 559 789 1.2e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1110 5e-73 PFAM
Pfam:Latrophilin 1129 1265 7.5e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117407
AA Change: D1070Y

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112388
Gene: ENSMUSG00000037605
AA Change: D1070Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 2.4e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 6e-8 PFAM
Pfam:DUF3497 627 857 2.6e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1178 7.7e-73 PFAM
Pfam:Latrophilin 1197 1321 1.8e-61 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117985
AA Change: D1002Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113950
Gene: ENSMUSG00000037605
AA Change: D1002Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 1.3e-26 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 5.5e-8 PFAM
Pfam:DUF3497 559 789 1.6e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1119 1.7e-72 PFAM
Pfam:Latrophilin 1138 1512 6.8e-178 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000118034
AA Change: D1002Y

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113534
Gene: ENSMUSG00000037605
AA Change: D1002Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 1.2e-26 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 5.5e-8 PFAM
Pfam:DUF3497 559 789 1.6e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1110 6.6e-73 PFAM
Pfam:Latrophilin 1129 1503 6.7e-178 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118078
AA Change: D1002Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112731
Gene: ENSMUSG00000037605
AA Change: D1002Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 9.7e-27 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 4.3e-8 PFAM
Pfam:DUF3497 559 789 1.2e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1110 4.8e-73 PFAM
Pfam:Latrophilin 1129 1201 2.6e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118442
AA Change: D1070Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113836
Gene: ENSMUSG00000037605
AA Change: D1070Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 1e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 4.7e-8 PFAM
Pfam:DUF3497 627 857 1.3e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1187 1.4e-72 PFAM
Pfam:Latrophilin 1206 1278 2.8e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119385
AA Change: D1070Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113243
Gene: ENSMUSG00000037605
AA Change: D1070Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 1e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 4.6e-8 PFAM
Pfam:DUF3497 627 857 1.3e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1178 5.2e-73 PFAM
Pfam:Latrophilin 1197 1269 2.7e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119788
AA Change: D1070Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114067
Gene: ENSMUSG00000037605
AA Change: D1070Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 1.3e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 5.7e-8 PFAM
Pfam:DUF3497 627 857 1.7e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1187 1.8e-72 PFAM
Pfam:Latrophilin 1206 1279 3.6e-31 PFAM
Pfam:Latrophilin 1273 1550 4.5e-113 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120128
AA Change: D1002Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113208
Gene: ENSMUSG00000037605
AA Change: D1002Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 9.8e-27 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 4.4e-8 PFAM
Pfam:DUF3497 559 789 1.2e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1119 1.3e-72 PFAM
Pfam:Latrophilin 1138 1210 2.6e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120144
AA Change: D1002Y

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113619
Gene: ENSMUSG00000037605
AA Change: D1002Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 1e-26 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 4.5e-8 PFAM
Pfam:DUF3497 559 789 1.3e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1110 5.1e-73 PFAM
Pfam:Latrophilin 1129 1253 8.4e-62 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120292
AA Change: D1002Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112548
Gene: ENSMUSG00000037605
AA Change: D1002Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 1e-26 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 4.5e-8 PFAM
Pfam:DUF3497 559 789 1.3e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1119 1.3e-72 PFAM
Pfam:Latrophilin 1138 1262 8.5e-62 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120445
AA Change: D1070Y

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113249
Gene: ENSMUSG00000037605
AA Change: D1070Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 2.2e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 2.8e-8 PFAM
Pfam:GAIN 630 856 5.1e-59 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1187 1.4e-73 PFAM
Pfam:Latrophilin 1207 1328 8e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120673
AA Change: D1070Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113482
Gene: ENSMUSG00000037605
AA Change: D1070Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 2.7e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 3.3e-8 PFAM
Pfam:GAIN 630 856 6.4e-59 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1187 1.8e-73 PFAM
Pfam:Latrophilin 1207 1580 1.4e-158 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121641
AA Change: D1070Y

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113694
Gene: ENSMUSG00000037605
AA Change: D1070Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 1.3e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 5.8e-8 PFAM
Pfam:DUF3497 627 857 1.7e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1178 7e-73 PFAM
Pfam:Latrophilin 1197 1571 7.3e-178 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121707
AA Change: D1070Y

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112823
Gene: ENSMUSG00000037605
AA Change: D1070Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 1.3e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 5.6e-8 PFAM
Pfam:DUF3497 627 857 1.7e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1178 6.8e-73 PFAM
Pfam:Latrophilin 1197 1267 6.4e-30 PFAM
Pfam:Latrophilin 1263 1534 8.7e-113 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000122037
AA Change: D1002Y

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113374
Gene: ENSMUSG00000037605
AA Change: D1002Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 1.2e-26 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 5.3e-8 PFAM
Pfam:DUF3497 559 789 1.5e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1110 6.3e-73 PFAM
Pfam:Latrophilin 1129 1199 4.4e-30 PFAM
Pfam:Latrophilin 1194 1460 1.3e-112 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000122356
AA Change: D1070Y

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113600
Gene: ENSMUSG00000037605
AA Change: D1070Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 2.8e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 7e-8 PFAM
Pfam:DUF3497 627 857 3.1e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1178 9.3e-73 PFAM
Pfam:Latrophilin 1197 1267 9e-30 PFAM
Pfam:Latrophilin 1262 1528 2.8e-112 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000118882
Gene: ENSMUSG00000037605
AA Change: D414Y

DomainStartEndE-ValueType
Pfam:GAIN 2 201 1.8e-51 PFAM
GPS 227 279 3.72e-25 SMART
Pfam:7tm_2 287 523 9.1e-75 PFAM
Pfam:Latrophilin 543 610 7.2e-35 PFAM
Pfam:Latrophilin 607 873 1.8e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132375
SMART Domains Protein: ENSMUSP00000117211
Gene: ENSMUSG00000037605

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Meta Mutation Damage Score 0.9149 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the latrophilin subfamily of G-protein coupled receptors (GPCR). Latrophilins may function in both cell adhesion and signal transduction. In experiments with non-human species, endogenous proteolytic cleavage within a cysteine-rich GPS (G-protein-coupled-receptor proteolysis site) domain resulted in two subunits (a large extracellular N-terminal cell adhesion subunit and a subunit with substantial similarity to the secretin/calcitonin family of GPCRs) being non-covalently bound at the cell membrane. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased dopamine and serotonine levels in the dorsal striatum, hyperactivity, increased stereotypic behavior and enhanced hyperactivity in response to cocaine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik T C 10: 28,862,140 (GRCm39) Y50C probably damaging Het
Aoc3 G A 11: 101,223,042 (GRCm39) R426H probably benign Het
Atf6b A G 17: 34,869,320 (GRCm39) H179R probably benign Het
Bbs4 T C 9: 59,247,138 (GRCm39) T121A probably benign Het
Brca1 T C 11: 101,380,672 (GRCm39) Y1787C probably benign Het
Cbx2 T A 11: 118,918,746 (GRCm39) S104T possibly damaging Het
Cdh10 T A 15: 18,899,851 (GRCm39) N59K possibly damaging Het
Clstn3 C T 6: 124,433,867 (GRCm39) R431H probably damaging Het
Cylc2 C T 4: 51,229,651 (GRCm39) T331M unknown Het
Dcpp3 T C 17: 24,138,096 (GRCm39) S85P probably benign Het
Dip2c A G 13: 9,687,161 (GRCm39) T1262A probably benign Het
Dlgap2 A G 8: 14,881,628 (GRCm39) E900G possibly damaging Het
Dtx4 C T 19: 12,446,995 (GRCm39) D566N probably benign Het
Elmo1 T A 13: 20,474,594 (GRCm39) N339K possibly damaging Het
Gm11596 C A 11: 99,683,816 (GRCm39) R101S unknown Het
Hk1 T C 10: 62,132,453 (GRCm39) probably benign Het
Hrnr T A 3: 93,230,205 (GRCm39) S148T unknown Het
Hyls1 A G 9: 35,472,724 (GRCm39) Y231H probably damaging Het
Il17rb T A 14: 29,726,297 (GRCm39) Y97F probably benign Het
Lamc1 G T 1: 153,109,288 (GRCm39) T1168K probably benign Het
Larp6 A T 9: 60,631,495 (GRCm39) D89V probably damaging Het
Muc4 C G 16: 32,575,221 (GRCm39) Q1269E probably benign Het
Myo18a A G 11: 77,745,520 (GRCm39) T1953A probably benign Het
Myo5c A G 9: 75,192,229 (GRCm39) D1127G possibly damaging Het
Myo7a T C 7: 97,746,334 (GRCm39) D266G probably benign Het
Naa35 T A 13: 59,734,036 (GRCm39) M22K probably benign Het
Niban2 T G 2: 32,809,101 (GRCm39) L229R probably benign Het
Or1f19 A T 16: 3,410,904 (GRCm39) I215F probably damaging Het
Pcdha8 T A 18: 37,127,003 (GRCm39) V495E probably damaging Het
Per2 T G 1: 91,378,402 (GRCm39) D49A possibly damaging Het
Plau G A 14: 20,889,627 (GRCm39) probably benign Het
Plekhg6 T A 6: 125,352,755 (GRCm39) I131L possibly damaging Het
Pnma8b T A 7: 16,679,965 (GRCm39) D316E unknown Het
Ppp4r3b T C 11: 29,159,436 (GRCm39) Y597H possibly damaging Het
Psmd2 T C 16: 20,474,161 (GRCm39) V288A probably benign Het
Slc6a15 T C 10: 103,245,556 (GRCm39) V513A possibly damaging Het
Smarcd3 G A 5: 24,800,988 (GRCm39) R140W probably damaging Het
Srrm4 T C 5: 116,585,380 (GRCm39) R440G unknown Het
Tpsg1 A T 17: 25,592,241 (GRCm39) Y105F possibly damaging Het
Trbv26 C A 6: 41,204,693 (GRCm39) A38E probably damaging Het
Ush2a T A 1: 188,198,401 (GRCm39) N1488K probably damaging Het
Vill A T 9: 118,895,795 (GRCm39) R502S probably benign Het
Zbed6 A T 1: 133,584,754 (GRCm39) L861* probably null Het
Other mutations in Adgrl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Adgrl3 APN 5 81,872,071 (GRCm39) missense probably damaging 0.99
IGL00596:Adgrl3 APN 5 81,794,314 (GRCm39) missense probably benign 0.01
IGL00766:Adgrl3 APN 5 81,942,415 (GRCm39) missense probably damaging 1.00
IGL00787:Adgrl3 APN 5 81,841,401 (GRCm39) missense probably damaging 1.00
IGL00917:Adgrl3 APN 5 81,841,421 (GRCm39) missense possibly damaging 0.93
IGL01155:Adgrl3 APN 5 81,708,740 (GRCm39) missense probably benign 0.39
IGL01348:Adgrl3 APN 5 81,874,570 (GRCm39) missense probably damaging 1.00
IGL01401:Adgrl3 APN 5 81,836,516 (GRCm39) missense possibly damaging 0.94
IGL01443:Adgrl3 APN 5 81,613,134 (GRCm39) missense probably damaging 1.00
IGL01532:Adgrl3 APN 5 81,842,416 (GRCm39) missense probably damaging 1.00
IGL01779:Adgrl3 APN 5 81,535,717 (GRCm39) missense probably damaging 1.00
IGL01920:Adgrl3 APN 5 81,613,143 (GRCm39) missense probably damaging 1.00
IGL02065:Adgrl3 APN 5 81,660,064 (GRCm39) missense probably damaging 1.00
IGL02365:Adgrl3 APN 5 81,660,428 (GRCm39) missense probably damaging 1.00
IGL02879:Adgrl3 APN 5 81,659,966 (GRCm39) missense probably damaging 1.00
R0010:Adgrl3 UTSW 5 81,940,250 (GRCm39) missense possibly damaging 0.58
R0077:Adgrl3 UTSW 5 81,919,532 (GRCm39) splice site probably benign
R0103:Adgrl3 UTSW 5 81,940,194 (GRCm39) intron probably benign
R0138:Adgrl3 UTSW 5 81,841,454 (GRCm39) missense probably damaging 1.00
R0149:Adgrl3 UTSW 5 81,908,544 (GRCm39) missense probably damaging 1.00
R0349:Adgrl3 UTSW 5 81,919,491 (GRCm39) missense probably damaging 1.00
R0361:Adgrl3 UTSW 5 81,908,544 (GRCm39) missense probably damaging 1.00
R0522:Adgrl3 UTSW 5 81,874,648 (GRCm39) missense possibly damaging 0.91
R0610:Adgrl3 UTSW 5 81,841,563 (GRCm39) splice site probably benign
R0658:Adgrl3 UTSW 5 81,796,560 (GRCm39) missense probably benign 0.18
R0671:Adgrl3 UTSW 5 81,708,752 (GRCm39) missense probably benign 0.45
R0679:Adgrl3 UTSW 5 81,942,824 (GRCm39) missense probably damaging 1.00
R1413:Adgrl3 UTSW 5 81,841,366 (GRCm39) missense probably damaging 1.00
R1444:Adgrl3 UTSW 5 81,660,200 (GRCm39) missense probably damaging 1.00
R1574:Adgrl3 UTSW 5 81,935,296 (GRCm39) missense probably damaging 1.00
R1574:Adgrl3 UTSW 5 81,935,296 (GRCm39) missense probably damaging 1.00
R1738:Adgrl3 UTSW 5 81,535,826 (GRCm39) missense probably damaging 0.99
R1744:Adgrl3 UTSW 5 81,942,267 (GRCm39) missense probably damaging 1.00
R1803:Adgrl3 UTSW 5 81,919,464 (GRCm39) nonsense probably null
R1891:Adgrl3 UTSW 5 81,659,891 (GRCm39) missense probably damaging 1.00
R1988:Adgrl3 UTSW 5 81,836,414 (GRCm39) missense probably damaging 1.00
R2126:Adgrl3 UTSW 5 81,660,383 (GRCm39) missense probably damaging 1.00
R2136:Adgrl3 UTSW 5 81,660,101 (GRCm39) missense probably damaging 1.00
R2171:Adgrl3 UTSW 5 81,660,362 (GRCm39) nonsense probably null
R2891:Adgrl3 UTSW 5 81,841,366 (GRCm39) missense probably damaging 1.00
R3508:Adgrl3 UTSW 5 81,872,103 (GRCm39) missense probably damaging 1.00
R3732:Adgrl3 UTSW 5 81,942,793 (GRCm39) missense probably benign 0.05
R3732:Adgrl3 UTSW 5 81,942,793 (GRCm39) missense probably benign 0.05
R3733:Adgrl3 UTSW 5 81,942,793 (GRCm39) missense probably benign 0.05
R3982:Adgrl3 UTSW 5 81,842,373 (GRCm39) missense possibly damaging 0.95
R4085:Adgrl3 UTSW 5 81,660,391 (GRCm39) missense probably benign 0.02
R4462:Adgrl3 UTSW 5 81,836,357 (GRCm39) missense probably damaging 1.00
R4725:Adgrl3 UTSW 5 81,914,052 (GRCm39) missense possibly damaging 0.67
R4726:Adgrl3 UTSW 5 81,794,425 (GRCm39) missense possibly damaging 0.61
R4781:Adgrl3 UTSW 5 81,908,571 (GRCm39) missense probably damaging 1.00
R4837:Adgrl3 UTSW 5 81,914,081 (GRCm39) missense probably benign 0.07
R4841:Adgrl3 UTSW 5 81,942,118 (GRCm39) missense possibly damaging 0.53
R4883:Adgrl3 UTSW 5 81,837,493 (GRCm39) missense probably damaging 1.00
R4921:Adgrl3 UTSW 5 81,659,957 (GRCm39) missense probably damaging 1.00
R4945:Adgrl3 UTSW 5 81,659,895 (GRCm39) missense probably damaging 1.00
R5055:Adgrl3 UTSW 5 81,794,398 (GRCm39) missense possibly damaging 0.48
R5313:Adgrl3 UTSW 5 81,874,516 (GRCm39) missense probably damaging 1.00
R5385:Adgrl3 UTSW 5 81,874,648 (GRCm39) missense probably damaging 1.00
R5447:Adgrl3 UTSW 5 81,613,188 (GRCm39) intron probably benign
R5482:Adgrl3 UTSW 5 81,942,360 (GRCm39) missense probably damaging 1.00
R5586:Adgrl3 UTSW 5 81,871,994 (GRCm39) missense probably damaging 0.99
R5637:Adgrl3 UTSW 5 81,841,391 (GRCm39) missense probably damaging 1.00
R5919:Adgrl3 UTSW 5 81,794,417 (GRCm39) missense probably benign 0.00
R6090:Adgrl3 UTSW 5 81,660,173 (GRCm39) missense probably damaging 1.00
R6093:Adgrl3 UTSW 5 81,794,369 (GRCm39) missense probably benign 0.42
R6107:Adgrl3 UTSW 5 81,836,410 (GRCm39) missense probably damaging 0.97
R6245:Adgrl3 UTSW 5 81,836,403 (GRCm39) missense probably benign 0.01
R6426:Adgrl3 UTSW 5 81,874,717 (GRCm39) missense probably damaging 1.00
R6440:Adgrl3 UTSW 5 81,942,341 (GRCm39) nonsense probably null
R6516:Adgrl3 UTSW 5 81,613,119 (GRCm39) missense probably damaging 1.00
R6527:Adgrl3 UTSW 5 81,935,364 (GRCm39) missense probably damaging 0.99
R6622:Adgrl3 UTSW 5 81,942,606 (GRCm39) missense probably benign 0.34
R6842:Adgrl3 UTSW 5 81,888,927 (GRCm39) missense probably damaging 1.00
R6902:Adgrl3 UTSW 5 81,837,434 (GRCm39) missense probably damaging 1.00
R6921:Adgrl3 UTSW 5 81,796,560 (GRCm39) missense probably damaging 0.99
R7201:Adgrl3 UTSW 5 81,872,069 (GRCm39) missense probably damaging 1.00
R7207:Adgrl3 UTSW 5 81,457,874 (GRCm39) start codon destroyed probably null 0.33
R7215:Adgrl3 UTSW 5 81,841,397 (GRCm39) missense probably damaging 1.00
R7376:Adgrl3 UTSW 5 81,942,597 (GRCm39) missense probably damaging 1.00
R7441:Adgrl3 UTSW 5 81,871,987 (GRCm39) missense possibly damaging 0.70
R7582:Adgrl3 UTSW 5 81,841,523 (GRCm39) missense probably damaging 0.99
R7682:Adgrl3 UTSW 5 81,942,407 (GRCm39) missense probably damaging 0.97
R7863:Adgrl3 UTSW 5 81,660,596 (GRCm39) missense probably damaging 1.00
R7877:Adgrl3 UTSW 5 81,842,467 (GRCm39) missense probably benign 0.30
R8051:Adgrl3 UTSW 5 81,613,113 (GRCm39) missense probably damaging 1.00
R8237:Adgrl3 UTSW 5 81,935,408 (GRCm39) frame shift probably null
R8390:Adgrl3 UTSW 5 81,914,057 (GRCm39) missense probably damaging 1.00
R8392:Adgrl3 UTSW 5 81,794,397 (GRCm39) missense probably benign 0.01
R8475:Adgrl3 UTSW 5 81,871,976 (GRCm39) missense probably benign 0.31
R8478:Adgrl3 UTSW 5 81,942,348 (GRCm39) missense possibly damaging 0.87
R8550:Adgrl3 UTSW 5 81,942,599 (GRCm39) missense possibly damaging 0.79
R8792:Adgrl3 UTSW 5 81,836,522 (GRCm39) missense probably damaging 0.99
R8851:Adgrl3 UTSW 5 81,613,119 (GRCm39) missense probably damaging 1.00
R8868:Adgrl3 UTSW 5 81,794,451 (GRCm39) missense probably benign
R8889:Adgrl3 UTSW 5 81,874,516 (GRCm39) missense probably damaging 1.00
R8892:Adgrl3 UTSW 5 81,874,516 (GRCm39) missense probably damaging 1.00
R8942:Adgrl3 UTSW 5 81,796,568 (GRCm39) missense probably benign 0.09
R9023:Adgrl3 UTSW 5 81,613,065 (GRCm39) missense probably damaging 0.99
R9089:Adgrl3 UTSW 5 81,808,291 (GRCm39) missense possibly damaging 0.77
R9100:Adgrl3 UTSW 5 81,842,299 (GRCm39) missense possibly damaging 0.85
R9104:Adgrl3 UTSW 5 81,457,912 (GRCm39) missense probably benign 0.00
R9172:Adgrl3 UTSW 5 81,922,251 (GRCm39) missense probably benign 0.01
R9284:Adgrl3 UTSW 5 81,657,568 (GRCm39) splice site probably benign
R9286:Adgrl3 UTSW 5 81,794,413 (GRCm39) missense probably benign
R9644:Adgrl3 UTSW 5 81,872,036 (GRCm39) missense probably damaging 0.99
R9689:Adgrl3 UTSW 5 81,942,780 (GRCm39) missense probably damaging 0.98
R9757:Adgrl3 UTSW 5 81,613,086 (GRCm39) missense probably benign 0.07
R9795:Adgrl3 UTSW 5 81,837,421 (GRCm39) missense probably damaging 1.00
Z1088:Adgrl3 UTSW 5 81,660,005 (GRCm39) missense probably damaging 1.00
Z1088:Adgrl3 UTSW 5 81,477,729 (GRCm39) missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TATTCGGAAACTGAAGCCTGG -3'
(R):5'- TACATTGAATCACACTCTCAGTTGC -3'

Sequencing Primer
(F):5'- GAAACTGAAGCCTGGGTTCATTTTTC -3'
(R):5'- GAATCACACTCTCAGTTGCTTCTACG -3'
Posted On 2021-03-08