Mutagenetix > Incidental Mutation

Incidental Mutation 'R8685:Slc6a15'

661995

Institutional Source

Beutler Lab

Gene Symbol

Slc6a15

Ensembl Gene

ENSMUSG00000019894

Gene Name

solute carrier family 6 (neurotransmitter transporter), member 15

Synonyms

v7-3

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8685 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

103367783-103419377 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 103409695 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 513 (V513A)

Ref Sequence

ENSEMBL: ENSMUSP00000073829 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074204] [ENSMUST00000179636]

AlphaFold

Q8BG16

Predicted Effect

possibly damaging
Transcript: ENSMUST00000074204
AA Change: V513A

PolyPhen 2 Score 0.681 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000073829
Gene: ENSMUSG00000019894
AA Change: V513A

Domain	Start	End	E-Value	Type
low complexity region	29	38	N/A	INTRINSIC
Pfam:SNF	61	644	2.2e-229	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000179636
AA Change: V513A

PolyPhen 2 Score 0.681 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000136676
Gene: ENSMUSG00000019894
AA Change: V513A

Domain	Start	End	E-Value	Type
low complexity region	29	38	N/A	INTRINSIC
Pfam:SNF	61	644	2.2e-229	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.9%
20x: 99.7%

Validation Efficiency

100% (44/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the solute carrier family 6 protein family which transports neutral amino acids. The encoded protein is thought to play a role in neuronal amino acid transport (PMID: 16185194) and may be associated with major depression (PMID: 21521612). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased synaptosome transport activities but exhibit no behavioral abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057J18Rik	T	C	10: 28,986,144	Y50C	probably damaging	Het
Adgrl3	G	T	5: 81,726,861	D1002Y	possibly damaging	Het
Aoc3	G	A	11: 101,332,216	R426H	probably benign	Het
Atf6b	A	G	17: 34,650,346	H179R	probably benign	Het
Bbs4	T	C	9: 59,339,855	T121A	probably benign	Het
Brca1	T	C	11: 101,489,846	Y1787C	probably benign	Het
Cbx2	T	A	11: 119,027,920	S104T	possibly damaging	Het
Cdh10	T	A	15: 18,899,765	N59K	possibly damaging	Het
Clstn3	C	T	6: 124,456,908	R431H	probably damaging	Het
Cylc2	C	T	4: 51,229,651	T331M	unknown	Het
Dcpp3	T	C	17: 23,919,122	S85P	probably benign	Het
Dip2c	A	G	13: 9,637,125	T1262A	probably benign	Het
Dlgap2	A	G	8: 14,831,628	E900G	possibly damaging	Het
Dtx4	C	T	19: 12,469,631	D566N	probably benign	Het
Elmo1	T	A	13: 20,290,424	N339K	possibly damaging	Het
Fam129b	T	G	2: 32,919,089	L229R	probably benign	Het
Gm11596	C	A	11: 99,792,990	R101S	unknown	Het
Gm38394	A	T	1: 133,657,016	L861*	probably null	Het
Hk1	T	C	10: 62,296,674		probably benign	Het
Hrnr	T	A	3: 93,322,898	S148T	unknown	Het
Hyls1	A	G	9: 35,561,428	Y231H	probably damaging	Het
Il17rb	T	A	14: 30,004,340	Y97F	probably benign	Het
Lamc1	G	T	1: 153,233,542	T1168K	probably benign	Het
Larp6	A	T	9: 60,724,212	D89V	probably damaging	Het
Muc4	C	G	16: 32,753,930	Q1269E	probably benign	Het
Myo18a	A	G	11: 77,854,694	T1953A	probably benign	Het
Myo5c	A	G	9: 75,284,947	D1127G	possibly damaging	Het
Myo7a	T	C	7: 98,097,127	D266G	probably benign	Het
Naa35	T	A	13: 59,586,222	M22K	probably benign	Het
Olfr161	A	T	16: 3,593,040	I215F	probably damaging	Het
Pcdha8	T	A	18: 36,993,950	V495E	probably damaging	Het
Per2	T	G	1: 91,450,680	D49A	possibly damaging	Het
Plau	G	A	14: 20,839,559		probably benign	Het
Plekhg6	T	A	6: 125,375,792	I131L	possibly damaging	Het
Pnmal2	T	A	7: 16,946,040	D316E	unknown	Het
Ppp4r3b	T	C	11: 29,209,436	Y597H	possibly damaging	Het
Psmd2	T	C	16: 20,655,411	V288A	probably benign	Het
Smarcd3	G	A	5: 24,595,990	R140W	probably damaging	Het
Srrm4	T	C	5: 116,447,321	R440G	unknown	Het
Tpsg1	A	T	17: 25,373,267	Y105F	possibly damaging	Het
Trbv26	C	A	6: 41,227,759	A38E	probably damaging	Het
Ush2a	T	A	1: 188,466,204	N1488K	probably damaging	Het
Vill	A	T	9: 119,066,727	R502S	probably benign	Het

Other mutations in Slc6a15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00504:Slc6a15	APN	10	103389141	missense	probably benign
IGL01320:Slc6a15	APN	10	103404745	missense	probably benign	0.00
IGL01924:Slc6a15	APN	10	103404825	splice site	probably null
IGL02066:Slc6a15	APN	10	103416658	missense	probably damaging	0.98
IGL02164:Slc6a15	APN	10	103418222	missense	probably benign	0.01
IGL02551:Slc6a15	APN	10	103404275	splice site	probably benign
IGL02744:Slc6a15	APN	10	103418033	missense	probably benign	0.03
R0028:Slc6a15	UTSW	10	103416680	missense	probably benign	0.00
R0143:Slc6a15	UTSW	10	103418068	missense	probably benign	0.02
R0158:Slc6a15	UTSW	10	103389347	splice site	probably benign
R0165:Slc6a15	UTSW	10	103409809	missense	probably null	0.04
R0349:Slc6a15	UTSW	10	103418225	missense	probably benign	0.06
R0383:Slc6a15	UTSW	10	103418053	missense	probably damaging	1.00
R0614:Slc6a15	UTSW	10	103404352	nonsense	probably null
R0784:Slc6a15	UTSW	10	103416800	splice site	probably benign
R0944:Slc6a15	UTSW	10	103409796	missense	probably benign	0.01
R1795:Slc6a15	UTSW	10	103400260	missense	probably benign
R1882:Slc6a15	UTSW	10	103395064	missense	probably benign	0.20
R2061:Slc6a15	UTSW	10	103409734	missense	probably benign	0.20
R2156:Slc6a15	UTSW	10	103393408	missense	probably damaging	1.00
R2358:Slc6a15	UTSW	10	103416785	missense	probably benign	0.00
R2849:Slc6a15	UTSW	10	103404691	missense	probably benign	0.01
R2921:Slc6a15	UTSW	10	103418387	missense	probably damaging	0.99
R3709:Slc6a15	UTSW	10	103393414	missense	probably benign	0.00
R4532:Slc6a15	UTSW	10	103409787	missense	possibly damaging	0.69
R4825:Slc6a15	UTSW	10	103418060	missense	probably benign	0.05
R4909:Slc6a15	UTSW	10	103404414	missense	probably damaging	1.00
R5112:Slc6a15	UTSW	10	103389226	missense	probably benign
R5320:Slc6a15	UTSW	10	103408206	missense	probably damaging	1.00
R5364:Slc6a15	UTSW	10	103393508	missense	probably damaging	0.99
R6305:Slc6a15	UTSW	10	103389170	missense	probably benign	0.31
R6348:Slc6a15	UTSW	10	103404367	missense	probably damaging	1.00
R6729:Slc6a15	UTSW	10	103393914	missense	probably damaging	0.99
R6781:Slc6a15	UTSW	10	103395067	missense	probably damaging	0.99
R7409:Slc6a15	UTSW	10	103408302	missense	probably benign
R7549:Slc6a15	UTSW	10	103389137	missense	probably benign
R7660:Slc6a15	UTSW	10	103393380	splice site	probably null
R7839:Slc6a15	UTSW	10	103404799	missense	probably benign
R7948:Slc6a15	UTSW	10	103404295	missense	possibly damaging	0.95
R8278:Slc6a15	UTSW	10	103394029	critical splice donor site	probably null
R8379:Slc6a15	UTSW	10	103389187	missense	probably benign	0.00
R8712:Slc6a15	UTSW	10	103389251	missense	probably damaging	1.00
R8719:Slc6a15	UTSW	10	103404315	missense	probably damaging	0.99
R8832:Slc6a15	UTSW	10	103389318	missense	probably damaging	1.00
R8940:Slc6a15	UTSW	10	103393496	missense	probably damaging	1.00
R8978:Slc6a15	UTSW	10	103395092	nonsense	probably null
R9050:Slc6a15	UTSW	10	103416655	missense	possibly damaging	0.88
R9113:Slc6a15	UTSW	10	103400279	missense	probably damaging	1.00
R9242:Slc6a15	UTSW	10	103393545	nonsense	probably null
R9493:Slc6a15	UTSW	10	103393416	missense	probably benign	0.35
R9529:Slc6a15	UTSW	10	103404722	missense	probably benign	0.14
R9532:Slc6a15	UTSW	10	103404472	missense	probably damaging	0.98
RF013:Slc6a15	UTSW	10	103400216	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGTGACTCAACTCCCAACATG -3'
(R):5'- AGCCTGTGAACTATTTGACTAGG -3'

Sequencing Primer
(F):5'- TTTCCATAGAGTCAGAGAAGCTAGTG -3'
(R):5'- CCTGTGAACTATTTGACTAGGTGAAG -3'

Posted On

2021-03-08