Incidental Mutation 'R8685:Slc6a15'
ID 661995
Institutional Source Beutler Lab
Gene Symbol Slc6a15
Ensembl Gene ENSMUSG00000019894
Gene Name solute carrier family 6 (neurotransmitter transporter), member 15
Synonyms v7-3
MMRRC Submission 068540-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8685 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 103203644-103255238 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 103245556 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 513 (V513A)
Ref Sequence ENSEMBL: ENSMUSP00000073829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074204] [ENSMUST00000179636]
AlphaFold Q8BG16
Predicted Effect possibly damaging
Transcript: ENSMUST00000074204
AA Change: V513A

PolyPhen 2 Score 0.681 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000073829
Gene: ENSMUSG00000019894
AA Change: V513A

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:SNF 61 644 2.2e-229 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000179636
AA Change: V513A

PolyPhen 2 Score 0.681 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000136676
Gene: ENSMUSG00000019894
AA Change: V513A

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:SNF 61 644 2.2e-229 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the solute carrier family 6 protein family which transports neutral amino acids. The encoded protein is thought to play a role in neuronal amino acid transport (PMID: 16185194) and may be associated with major depression (PMID: 21521612). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased synaptosome transport activities but exhibit no behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik T C 10: 28,862,140 (GRCm39) Y50C probably damaging Het
Adgrl3 G T 5: 81,874,708 (GRCm39) D1002Y possibly damaging Het
Aoc3 G A 11: 101,223,042 (GRCm39) R426H probably benign Het
Atf6b A G 17: 34,869,320 (GRCm39) H179R probably benign Het
Bbs4 T C 9: 59,247,138 (GRCm39) T121A probably benign Het
Brca1 T C 11: 101,380,672 (GRCm39) Y1787C probably benign Het
Cbx2 T A 11: 118,918,746 (GRCm39) S104T possibly damaging Het
Cdh10 T A 15: 18,899,851 (GRCm39) N59K possibly damaging Het
Clstn3 C T 6: 124,433,867 (GRCm39) R431H probably damaging Het
Cylc2 C T 4: 51,229,651 (GRCm39) T331M unknown Het
Dcpp3 T C 17: 24,138,096 (GRCm39) S85P probably benign Het
Dip2c A G 13: 9,687,161 (GRCm39) T1262A probably benign Het
Dlgap2 A G 8: 14,881,628 (GRCm39) E900G possibly damaging Het
Dtx4 C T 19: 12,446,995 (GRCm39) D566N probably benign Het
Elmo1 T A 13: 20,474,594 (GRCm39) N339K possibly damaging Het
Gm11596 C A 11: 99,683,816 (GRCm39) R101S unknown Het
Hk1 T C 10: 62,132,453 (GRCm39) probably benign Het
Hrnr T A 3: 93,230,205 (GRCm39) S148T unknown Het
Hyls1 A G 9: 35,472,724 (GRCm39) Y231H probably damaging Het
Il17rb T A 14: 29,726,297 (GRCm39) Y97F probably benign Het
Lamc1 G T 1: 153,109,288 (GRCm39) T1168K probably benign Het
Larp6 A T 9: 60,631,495 (GRCm39) D89V probably damaging Het
Muc4 C G 16: 32,575,221 (GRCm39) Q1269E probably benign Het
Myo18a A G 11: 77,745,520 (GRCm39) T1953A probably benign Het
Myo5c A G 9: 75,192,229 (GRCm39) D1127G possibly damaging Het
Myo7a T C 7: 97,746,334 (GRCm39) D266G probably benign Het
Naa35 T A 13: 59,734,036 (GRCm39) M22K probably benign Het
Niban2 T G 2: 32,809,101 (GRCm39) L229R probably benign Het
Or1f19 A T 16: 3,410,904 (GRCm39) I215F probably damaging Het
Pcdha8 T A 18: 37,127,003 (GRCm39) V495E probably damaging Het
Per2 T G 1: 91,378,402 (GRCm39) D49A possibly damaging Het
Plau G A 14: 20,889,627 (GRCm39) probably benign Het
Plekhg6 T A 6: 125,352,755 (GRCm39) I131L possibly damaging Het
Pnma8b T A 7: 16,679,965 (GRCm39) D316E unknown Het
Ppp4r3b T C 11: 29,159,436 (GRCm39) Y597H possibly damaging Het
Psmd2 T C 16: 20,474,161 (GRCm39) V288A probably benign Het
Smarcd3 G A 5: 24,800,988 (GRCm39) R140W probably damaging Het
Srrm4 T C 5: 116,585,380 (GRCm39) R440G unknown Het
Tpsg1 A T 17: 25,592,241 (GRCm39) Y105F possibly damaging Het
Trbv26 C A 6: 41,204,693 (GRCm39) A38E probably damaging Het
Ush2a T A 1: 188,198,401 (GRCm39) N1488K probably damaging Het
Vill A T 9: 118,895,795 (GRCm39) R502S probably benign Het
Zbed6 A T 1: 133,584,754 (GRCm39) L861* probably null Het
Other mutations in Slc6a15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Slc6a15 APN 10 103,225,002 (GRCm39) missense probably benign
IGL01320:Slc6a15 APN 10 103,240,606 (GRCm39) missense probably benign 0.00
IGL01924:Slc6a15 APN 10 103,240,686 (GRCm39) splice site probably null
IGL02066:Slc6a15 APN 10 103,252,519 (GRCm39) missense probably damaging 0.98
IGL02164:Slc6a15 APN 10 103,254,083 (GRCm39) missense probably benign 0.01
IGL02551:Slc6a15 APN 10 103,240,136 (GRCm39) splice site probably benign
IGL02744:Slc6a15 APN 10 103,253,894 (GRCm39) missense probably benign 0.03
R0028:Slc6a15 UTSW 10 103,252,541 (GRCm39) missense probably benign 0.00
R0143:Slc6a15 UTSW 10 103,253,929 (GRCm39) missense probably benign 0.02
R0158:Slc6a15 UTSW 10 103,225,208 (GRCm39) splice site probably benign
R0165:Slc6a15 UTSW 10 103,245,670 (GRCm39) missense probably null 0.04
R0349:Slc6a15 UTSW 10 103,254,086 (GRCm39) missense probably benign 0.06
R0383:Slc6a15 UTSW 10 103,253,914 (GRCm39) missense probably damaging 1.00
R0614:Slc6a15 UTSW 10 103,240,213 (GRCm39) nonsense probably null
R0784:Slc6a15 UTSW 10 103,252,661 (GRCm39) splice site probably benign
R0944:Slc6a15 UTSW 10 103,245,657 (GRCm39) missense probably benign 0.01
R1795:Slc6a15 UTSW 10 103,236,121 (GRCm39) missense probably benign
R1882:Slc6a15 UTSW 10 103,230,925 (GRCm39) missense probably benign 0.20
R2061:Slc6a15 UTSW 10 103,245,595 (GRCm39) missense probably benign 0.20
R2156:Slc6a15 UTSW 10 103,229,269 (GRCm39) missense probably damaging 1.00
R2358:Slc6a15 UTSW 10 103,252,646 (GRCm39) missense probably benign 0.00
R2849:Slc6a15 UTSW 10 103,240,552 (GRCm39) missense probably benign 0.01
R2921:Slc6a15 UTSW 10 103,254,248 (GRCm39) missense probably damaging 0.99
R3709:Slc6a15 UTSW 10 103,229,275 (GRCm39) missense probably benign 0.00
R4532:Slc6a15 UTSW 10 103,245,648 (GRCm39) missense possibly damaging 0.69
R4825:Slc6a15 UTSW 10 103,253,921 (GRCm39) missense probably benign 0.05
R4909:Slc6a15 UTSW 10 103,240,275 (GRCm39) missense probably damaging 1.00
R5112:Slc6a15 UTSW 10 103,225,087 (GRCm39) missense probably benign
R5320:Slc6a15 UTSW 10 103,244,067 (GRCm39) missense probably damaging 1.00
R5364:Slc6a15 UTSW 10 103,229,369 (GRCm39) missense probably damaging 0.99
R6305:Slc6a15 UTSW 10 103,225,031 (GRCm39) missense probably benign 0.31
R6348:Slc6a15 UTSW 10 103,240,228 (GRCm39) missense probably damaging 1.00
R6729:Slc6a15 UTSW 10 103,229,775 (GRCm39) missense probably damaging 0.99
R6781:Slc6a15 UTSW 10 103,230,928 (GRCm39) missense probably damaging 0.99
R7409:Slc6a15 UTSW 10 103,244,163 (GRCm39) missense probably benign
R7549:Slc6a15 UTSW 10 103,224,998 (GRCm39) missense probably benign
R7660:Slc6a15 UTSW 10 103,229,241 (GRCm39) splice site probably null
R7839:Slc6a15 UTSW 10 103,240,660 (GRCm39) missense probably benign
R7948:Slc6a15 UTSW 10 103,240,156 (GRCm39) missense possibly damaging 0.95
R8278:Slc6a15 UTSW 10 103,229,890 (GRCm39) critical splice donor site probably null
R8379:Slc6a15 UTSW 10 103,225,048 (GRCm39) missense probably benign 0.00
R8712:Slc6a15 UTSW 10 103,225,112 (GRCm39) missense probably damaging 1.00
R8719:Slc6a15 UTSW 10 103,240,176 (GRCm39) missense probably damaging 0.99
R8832:Slc6a15 UTSW 10 103,225,179 (GRCm39) missense probably damaging 1.00
R8940:Slc6a15 UTSW 10 103,229,357 (GRCm39) missense probably damaging 1.00
R8978:Slc6a15 UTSW 10 103,230,953 (GRCm39) nonsense probably null
R9050:Slc6a15 UTSW 10 103,252,516 (GRCm39) missense possibly damaging 0.88
R9113:Slc6a15 UTSW 10 103,236,140 (GRCm39) missense probably damaging 1.00
R9242:Slc6a15 UTSW 10 103,229,406 (GRCm39) nonsense probably null
R9493:Slc6a15 UTSW 10 103,229,277 (GRCm39) missense probably benign 0.35
R9529:Slc6a15 UTSW 10 103,240,583 (GRCm39) missense probably benign 0.14
R9532:Slc6a15 UTSW 10 103,240,333 (GRCm39) missense probably damaging 0.98
RF013:Slc6a15 UTSW 10 103,236,077 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTGACTCAACTCCCAACATG -3'
(R):5'- AGCCTGTGAACTATTTGACTAGG -3'

Sequencing Primer
(F):5'- TTTCCATAGAGTCAGAGAAGCTAGTG -3'
(R):5'- CCTGTGAACTATTTGACTAGGTGAAG -3'
Posted On 2021-03-08