Incidental Mutation 'R8685:Brca1'
ID662000
Institutional Source Beutler Lab
Gene Symbol Brca1
Ensembl Gene ENSMUSG00000017146
Gene Namebreast cancer 1, early onset
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8685 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location101488764-101551955 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101489846 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1787 (Y1787C)
Ref Sequence ENSEMBL: ENSMUSP00000017290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017290]
Predicted Effect probably benign
Transcript: ENSMUST00000017290
AA Change: Y1787C

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000017290
Gene: ENSMUSG00000017146
AA Change: Y1787C

DomainStartEndE-ValueType
RING 24 64 1.82e-7 SMART
Pfam:BRCT_assoc 342 503 2.6e-69 PFAM
low complexity region 1173 1185 N/A INTRINSIC
Blast:BRCT 1343 1406 2e-16 BLAST
low complexity region 1555 1575 N/A INTRINSIC
BRCT 1587 1669 3.87e-11 SMART
BRCT 1700 1787 3.42e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA1 protein survive, have a kinky tail, pigmentation anomalies, male infertility and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik T C 10: 28,986,144 Y50C probably damaging Het
Adgrl3 G T 5: 81,726,861 D1002Y possibly damaging Het
Aoc3 G A 11: 101,332,216 R426H probably benign Het
Atf6b A G 17: 34,650,346 H179R probably benign Het
Bbs4 T C 9: 59,339,855 T121A probably benign Het
Cbx2 T A 11: 119,027,920 S104T possibly damaging Het
Cdh10 T A 15: 18,899,765 N59K possibly damaging Het
Clstn3 C T 6: 124,456,908 R431H probably damaging Het
Cylc2 C T 4: 51,229,651 T331M unknown Het
Dcpp3 T C 17: 23,919,122 S85P probably benign Het
Dip2c A G 13: 9,637,125 T1262A probably benign Het
Dlgap2 A G 8: 14,831,628 E900G possibly damaging Het
Dtx4 C T 19: 12,469,631 D566N probably benign Het
Elmo1 T A 13: 20,290,424 N339K possibly damaging Het
Fam129b T G 2: 32,919,089 L229R probably benign Het
Gm11596 C A 11: 99,792,990 R101S unknown Het
Gm38394 A T 1: 133,657,016 L861* probably null Het
Hk1 T C 10: 62,296,674 probably benign Het
Hrnr T A 3: 93,322,898 S148T unknown Het
Hyls1 A G 9: 35,561,428 Y231H probably damaging Het
Il17rb T A 14: 30,004,340 Y97F probably benign Het
Lamc1 G T 1: 153,233,542 T1168K probably benign Het
Larp6 A T 9: 60,724,212 D89V probably damaging Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Myo18a A G 11: 77,854,694 T1953A probably benign Het
Myo5c A G 9: 75,284,947 D1127G possibly damaging Het
Myo7a T C 7: 98,097,127 D266G probably benign Het
Naa35 T A 13: 59,586,222 M22K probably benign Het
Olfr161 A T 16: 3,593,040 I215F probably damaging Het
Pcdha8 T A 18: 36,993,950 V495E probably damaging Het
Per2 T G 1: 91,450,680 D49A possibly damaging Het
Plau G A 14: 20,839,559 probably benign Het
Plekhg6 T A 6: 125,375,792 I131L possibly damaging Het
Pnmal2 T A 7: 16,946,040 D316E unknown Het
Ppp4r3b T C 11: 29,209,436 Y597H possibly damaging Het
Psmd2 T C 16: 20,655,411 V288A probably benign Het
Slc6a15 T C 10: 103,409,695 V513A possibly damaging Het
Smarcd3 G A 5: 24,595,990 R140W probably damaging Het
Srrm4 T C 5: 116,447,321 R440G unknown Het
Tpsg1 A T 17: 25,373,267 Y105F possibly damaging Het
Trbv26 C A 6: 41,227,759 A38E probably damaging Het
Ush2a T A 1: 188,466,204 N1488K probably damaging Het
Vill A T 9: 119,066,727 R502S probably benign Het
Other mutations in Brca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Brca1 APN 11 101524369 missense possibly damaging 0.71
IGL01598:Brca1 APN 11 101524330 missense probably benign 0.04
IGL01744:Brca1 APN 11 101524176 missense possibly damaging 0.73
IGL02128:Brca1 APN 11 101530982 unclassified probably benign
IGL02377:Brca1 APN 11 101524323 missense probably benign 0.01
IGL02701:Brca1 APN 11 101525235 missense probably damaging 1.00
IGL02732:Brca1 APN 11 101492219 missense probably benign 0.07
IGL02935:Brca1 APN 11 101489867 missense probably benign 0.00
IGL02940:Brca1 APN 11 101489912 missense probably benign 0.00
IGL03198:Brca1 APN 11 101512711 splice site probably benign
BB002:Brca1 UTSW 11 101508146 missense probably benign 0.01
BB009:Brca1 UTSW 11 101540017 missense possibly damaging 0.85
BB012:Brca1 UTSW 11 101508146 missense probably benign 0.01
BB019:Brca1 UTSW 11 101540017 missense possibly damaging 0.85
PIT4142001:Brca1 UTSW 11 101522422 unclassified probably benign
R0048:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R0048:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R0109:Brca1 UTSW 11 101531090 missense possibly damaging 0.85
R0109:Brca1 UTSW 11 101531090 missense possibly damaging 0.85
R0144:Brca1 UTSW 11 101526121 missense probably damaging 1.00
R0336:Brca1 UTSW 11 101523993 missense probably benign 0.04
R0448:Brca1 UTSW 11 101508221 missense possibly damaging 0.93
R0595:Brca1 UTSW 11 101524887 missense probably benign 0.27
R0613:Brca1 UTSW 11 101508210 missense probably benign 0.18
R0863:Brca1 UTSW 11 101524770 missense probably benign 0.36
R0940:Brca1 UTSW 11 101532143 missense possibly damaging 0.73
R0962:Brca1 UTSW 11 101525366 missense possibly damaging 0.46
R1365:Brca1 UTSW 11 101501996 missense probably benign
R1391:Brca1 UTSW 11 101526546 missense possibly damaging 0.53
R1467:Brca1 UTSW 11 101531107 unclassified probably benign
R1484:Brca1 UTSW 11 101529812 missense possibly damaging 0.86
R1530:Brca1 UTSW 11 101524695 missense probably damaging 1.00
R1645:Brca1 UTSW 11 101510053 missense probably benign 0.00
R1682:Brca1 UTSW 11 101525565 missense probably damaging 0.98
R1687:Brca1 UTSW 11 101489840 missense probably benign
R1694:Brca1 UTSW 11 101532099 missense probably damaging 0.98
R1695:Brca1 UTSW 11 101524455 missense probably damaging 0.97
R1762:Brca1 UTSW 11 101532018 critical splice donor site probably null
R1868:Brca1 UTSW 11 101498013 missense probably benign
R1973:Brca1 UTSW 11 101526403 missense probably benign 0.22
R2034:Brca1 UTSW 11 101489849 missense probably benign
R2106:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R4089:Brca1 UTSW 11 101524176 missense possibly damaging 0.73
R4194:Brca1 UTSW 11 101525287 missense probably benign 0.02
R4571:Brca1 UTSW 11 101517366 missense probably benign 0.00
R4735:Brca1 UTSW 11 101492175 splice site probably null
R4789:Brca1 UTSW 11 101523932 missense probably benign 0.00
R4920:Brca1 UTSW 11 101524959 missense probably damaging 1.00
R4939:Brca1 UTSW 11 101508050 missense probably benign
R4997:Brca1 UTSW 11 101524333 missense probably damaging 0.96
R5458:Brca1 UTSW 11 101517285 missense possibly damaging 0.53
R5778:Brca1 UTSW 11 101525301 missense possibly damaging 0.47
R6051:Brca1 UTSW 11 101524246 missense probably damaging 1.00
R6505:Brca1 UTSW 11 101523541 missense probably benign 0.03
R6548:Brca1 UTSW 11 101524765 missense probably damaging 1.00
R6971:Brca1 UTSW 11 101534005 missense probably benign 0.18
R7091:Brca1 UTSW 11 101526427 missense probably benign 0.00
R7246:Brca1 UTSW 11 101523378 missense probably benign 0.00
R7417:Brca1 UTSW 11 101524981 missense probably damaging 1.00
R7861:Brca1 UTSW 11 101526422 missense possibly damaging 0.87
R7925:Brca1 UTSW 11 101508146 missense probably benign 0.01
R7932:Brca1 UTSW 11 101540017 missense possibly damaging 0.85
R8003:Brca1 UTSW 11 101524477 missense probably benign 0.22
R8046:Brca1 UTSW 11 101525470 missense probably benign 0.03
R8306:Brca1 UTSW 11 101525637 missense probably damaging 1.00
R8483:Brca1 UTSW 11 101525976 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCCTCACATAGGTAGAAGCTGG -3'
(R):5'- TGGGCTTTTACCACGCTCAC -3'

Sequencing Primer
(F):5'- CACATAGGTAGAAGCTGGTTTTTCC -3'
(R):5'- CACTCCTTTGGCTTTTGAATAAGG -3'
Posted On2021-03-08