Incidental Mutation 'R8685:Dtx4'
ID 662014
Institutional Source Beutler Lab
Gene Symbol Dtx4
Ensembl Gene ENSMUSG00000039982
Gene Name deltex 4, E3 ubiquitin ligase
Synonyms RNF155
MMRRC Submission
Accession Numbers

Genbank: NM_001047855

Is this an essential gene? Possibly non essential (E-score: 0.399) question?
Stock # R8685 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 12466341-12501996 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 12469631 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 566 (D566N)
Ref Sequence ENSEMBL: ENSMUSP00000040229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045521] [ENSMUST00000081035]
AlphaFold Q6PDK8
Predicted Effect probably benign
Transcript: ENSMUST00000045521
AA Change: D566N

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000040229
Gene: ENSMUSG00000039982
AA Change: D566N

DomainStartEndE-ValueType
WWE 5 86 1.38e-38 SMART
WWE 88 163 6.72e-28 SMART
low complexity region 175 192 N/A INTRINSIC
low complexity region 372 386 N/A INTRINSIC
RING 406 464 2.2e-6 SMART
Blast:RING 510 532 3e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000081035
SMART Domains Protein: ENSMUSP00000108573
Gene: ENSMUSG00000046805

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
MACPF 151 350 2.13e-58 SMART
transmembrane domain 661 683 N/A INTRINSIC
low complexity region 685 698 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 100% (44/44)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik T C 10: 28,986,144 Y50C probably damaging Het
Adgrl3 G T 5: 81,726,861 D1002Y possibly damaging Het
Aoc3 G A 11: 101,332,216 R426H probably benign Het
Atf6b A G 17: 34,650,346 H179R probably benign Het
Bbs4 T C 9: 59,339,855 T121A probably benign Het
Brca1 T C 11: 101,489,846 Y1787C probably benign Het
Cbx2 T A 11: 119,027,920 S104T possibly damaging Het
Cdh10 T A 15: 18,899,765 N59K possibly damaging Het
Clstn3 C T 6: 124,456,908 R431H probably damaging Het
Cylc2 C T 4: 51,229,651 T331M unknown Het
Dcpp3 T C 17: 23,919,122 S85P probably benign Het
Dip2c A G 13: 9,637,125 T1262A probably benign Het
Dlgap2 A G 8: 14,831,628 E900G possibly damaging Het
Elmo1 T A 13: 20,290,424 N339K possibly damaging Het
Fam129b T G 2: 32,919,089 L229R probably benign Het
Gm11596 C A 11: 99,792,990 R101S unknown Het
Gm38394 A T 1: 133,657,016 L861* probably null Het
Hk1 T C 10: 62,296,674 probably benign Het
Hrnr T A 3: 93,322,898 S148T unknown Het
Hyls1 A G 9: 35,561,428 Y231H probably damaging Het
Il17rb T A 14: 30,004,340 Y97F probably benign Het
Lamc1 G T 1: 153,233,542 T1168K probably benign Het
Larp6 A T 9: 60,724,212 D89V probably damaging Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Myo18a A G 11: 77,854,694 T1953A probably benign Het
Myo5c A G 9: 75,284,947 D1127G possibly damaging Het
Myo7a T C 7: 98,097,127 D266G probably benign Het
Naa35 T A 13: 59,586,222 M22K probably benign Het
Olfr161 A T 16: 3,593,040 I215F probably damaging Het
Pcdha8 T A 18: 36,993,950 V495E probably damaging Het
Per2 T G 1: 91,450,680 D49A possibly damaging Het
Plau G A 14: 20,839,559 probably benign Het
Plekhg6 T A 6: 125,375,792 I131L possibly damaging Het
Pnmal2 T A 7: 16,946,040 D316E unknown Het
Ppp4r3b T C 11: 29,209,436 Y597H possibly damaging Het
Psmd2 T C 16: 20,655,411 V288A probably benign Het
Slc6a15 T C 10: 103,409,695 V513A possibly damaging Het
Smarcd3 G A 5: 24,595,990 R140W probably damaging Het
Srrm4 T C 5: 116,447,321 R440G unknown Het
Tpsg1 A T 17: 25,373,267 Y105F possibly damaging Het
Trbv26 C A 6: 41,227,759 A38E probably damaging Het
Ush2a T A 1: 188,466,204 N1488K probably damaging Het
Vill A T 9: 119,066,727 R502S probably benign Het
Other mutations in Dtx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01533:Dtx4 APN 19 12478215 missense possibly damaging 0.88
IGL02173:Dtx4 APN 19 12473257 nonsense probably null
IGL03127:Dtx4 APN 19 12486500 splice site probably benign
G5030:Dtx4 UTSW 19 12469579 missense probably benign 0.07
R0143:Dtx4 UTSW 19 12486482 missense probably damaging 0.98
R0932:Dtx4 UTSW 19 12492151 missense probably benign
R1066:Dtx4 UTSW 19 12501009 missense probably damaging 0.98
R2155:Dtx4 UTSW 19 12485282 nonsense probably null
R2182:Dtx4 UTSW 19 12483107 missense probably null 0.75
R2362:Dtx4 UTSW 19 12492535 missense probably damaging 1.00
R3880:Dtx4 UTSW 19 12486456 missense probably benign 0.01
R4108:Dtx4 UTSW 19 12501123 missense probably damaging 0.96
R4361:Dtx4 UTSW 19 12485296 missense probably benign 0.04
R4943:Dtx4 UTSW 19 12501060 missense probably damaging 1.00
R5361:Dtx4 UTSW 19 12485262 critical splice donor site probably null
R5440:Dtx4 UTSW 19 12492317 missense probably damaging 1.00
R5613:Dtx4 UTSW 19 12485403 missense probably damaging 0.97
R5614:Dtx4 UTSW 19 12482183 missense probably damaging 1.00
R5703:Dtx4 UTSW 19 12482210 missense possibly damaging 0.84
R5994:Dtx4 UTSW 19 12501153 missense probably damaging 1.00
R6695:Dtx4 UTSW 19 12473235 nonsense probably null
R7107:Dtx4 UTSW 19 12473260 nonsense probably null
R7208:Dtx4 UTSW 19 12482073 critical splice donor site probably null
R7231:Dtx4 UTSW 19 12469658 nonsense probably null
R7521:Dtx4 UTSW 19 12492497 missense probably benign 0.30
R7609:Dtx4 UTSW 19 12492281 missense probably damaging 1.00
R7721:Dtx4 UTSW 19 12482136 missense probably benign 0.09
R7775:Dtx4 UTSW 19 12492010 missense probably benign 0.02
Z1176:Dtx4 UTSW 19 12491909 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTAATCCAGCGCCCTCTGTG -3'
(R):5'- AGGGTTGCGGACATCAAGTC -3'

Sequencing Primer
(F):5'- AGGCATGGCATCAACCTTG -3'
(R):5'- GTCAAATCCACCATCTGACAACTGG -3'
Posted On 2021-03-08