Incidental Mutation 'R8686:Tfap2d'
ID 662015
Institutional Source Beutler Lab
Gene Symbol Tfap2d
Ensembl Gene ENSMUSG00000042596
Gene Name transcription factor AP-2, delta
Synonyms Tcfap2d
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8686 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 19103022-19166346 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 19108284 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 191 (N191S)
Ref Sequence ENSEMBL: ENSMUSP00000037699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037294]
AlphaFold Q91ZK0
Predicted Effect probably benign
Transcript: ENSMUST00000037294
AA Change: N191S

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000037699
Gene: ENSMUSG00000042596
AA Change: N191S

DomainStartEndE-ValueType
low complexity region 41 53 N/A INTRINSIC
low complexity region 96 107 N/A INTRINSIC
low complexity region 162 181 N/A INTRINSIC
Pfam:TF_AP-2 209 409 3.3e-91 PFAM
Meta Mutation Damage Score 0.0669 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (58/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit loss of inferior colliculus due to apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik C T 9: 103,259,428 A525T probably benign Het
Adam25 A G 8: 40,755,484 T596A probably benign Het
Adamts6 A G 13: 104,313,699 I303V probably damaging Het
Alpl A T 4: 137,743,801 H341Q probably damaging Het
Cachd1 G A 4: 100,988,128 R939H probably damaging Het
Ccdc114 A G 7: 45,947,692 T456A probably benign Het
Cd22 G A 7: 30,870,069 R541C probably benign Het
Cenpf A T 1: 189,659,604 M660K probably benign Het
Cmya5 A T 13: 93,095,380 S1067T possibly damaging Het
Col5a2 C T 1: 45,421,987 G250D probably damaging Het
Cylc2 C T 4: 51,229,651 T331M unknown Het
Dgka A G 10: 128,733,093 M201T probably benign Het
Dnajc13 T C 9: 104,170,805 I1804V probably benign Het
Dym T A 18: 75,286,683 Y642N probably damaging Het
Efr3b A T 12: 4,000,886 D26E probably damaging Het
Emilin1 A T 5: 30,917,696 K427M possibly damaging Het
Fam187b T C 7: 30,977,234 L56S probably benign Het
Fbxo18 C T 2: 11,755,658 V694I probably benign Het
Fgd2 C T 17: 29,379,023 T644I probably benign Het
G6pc T G 11: 101,374,707 probably null Het
Gli2 A G 1: 118,836,687 S1245P probably benign Het
Gm10696 T C 3: 94,176,120 D128G probably benign Het
Gpr137b T C 13: 13,359,406 Y355C Het
Ighv1-84 T C 12: 115,980,904 D50G probably benign Het
Impdh1 C A 6: 29,216,215 probably benign Het
Irf4 A T 13: 30,761,450 D393V possibly damaging Het
Kalrn A G 16: 34,360,935 L111P probably damaging Het
Lrch3 T C 16: 32,981,853 V58A possibly damaging Het
Lrif1 C T 3: 106,732,781 T394I probably damaging Het
Map4k1 A G 7: 28,994,073 T434A probably benign Het
Mcur1 G A 13: 43,541,717 T327M probably damaging Het
Mettl7b A T 10: 128,960,607 M111K possibly damaging Het
Myo9b G T 8: 71,334,322 S716I probably benign Het
Nol10 T A 12: 17,369,771 probably benign Het
Nos3 A G 5: 24,368,843 T202A possibly damaging Het
Olfr128 T C 17: 37,924,277 V237A probably benign Het
Olfr710 A C 7: 106,944,698 M101R probably benign Het
Parp12 A T 6: 39,117,922 S80T probably benign Het
Pde1a C T 2: 79,927,742 V50I probably benign Het
Pfkl A T 10: 77,997,522 probably null Het
Phkg1 A T 5: 129,866,215 Y207N probably damaging Het
Pik3r4 A G 9: 105,658,529 T640A possibly damaging Het
Pip5k1c C A 10: 81,311,993 H411N probably damaging Het
Pla2g4e A G 2: 120,244,691 S73P probably damaging Het
Polr2b T C 5: 77,335,663 V662A probably damaging Het
Prss43 C T 9: 110,829,426 R265C possibly damaging Het
Rap1b A T 10: 117,822,841 V29D probably damaging Het
Rraga A G 4: 86,576,811 E298G probably damaging Het
Rrp8 A T 7: 105,733,574 I418N probably damaging Het
Siglecf T C 7: 43,355,606 V420A probably benign Het
Snx14 T A 9: 88,415,693 N174I probably damaging Het
Speer4e T C 5: 14,934,115 N229S probably benign Het
Teddm3 A G 16: 21,152,935 *295Q probably null Het
Tfap2c A G 2: 172,552,006 D245G possibly damaging Het
Unc80 A G 1: 66,612,268 R1591G possibly damaging Het
Vmn1r116 T C 7: 20,872,691 W146R probably damaging Het
Vps13b C G 15: 35,925,389 S3823R probably damaging Het
Wiz T A 17: 32,367,847 D163V probably damaging Het
Xylt1 G C 7: 117,381,359 A61P unknown Het
Zfp521 A C 18: 13,845,644 F571V probably damaging Het
Zfp664 T A 5: 124,886,069 C176S possibly damaging Het
Zfyve26 T C 12: 79,287,453 N264D probably benign Het
Other mutations in Tfap2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Tfap2d APN 1 19142881 missense probably benign 0.44
IGL00837:Tfap2d APN 1 19119206 missense probably damaging 1.00
IGL01370:Tfap2d APN 1 19104785 missense probably damaging 0.96
IGL01470:Tfap2d APN 1 19148396 missense probably damaging 0.98
IGL01757:Tfap2d APN 1 19104580 missense probably benign
IGL01986:Tfap2d APN 1 19119159 splice site probably benign
IGL02613:Tfap2d APN 1 19119191 missense probably damaging 1.00
IGL02666:Tfap2d APN 1 19104755 missense probably benign 0.13
IGL02812:Tfap2d APN 1 19142927 missense possibly damaging 0.84
IGL02900:Tfap2d APN 1 19119250 missense probably damaging 1.00
IGL03184:Tfap2d APN 1 19118886 missense probably damaging 1.00
R0389:Tfap2d UTSW 1 19104367 missense possibly damaging 0.94
R0443:Tfap2d UTSW 1 19104367 missense possibly damaging 0.94
R3962:Tfap2d UTSW 1 19118965 missense probably damaging 1.00
R3977:Tfap2d UTSW 1 19104494 missense possibly damaging 0.76
R3980:Tfap2d UTSW 1 19165963 missense possibly damaging 0.69
R4721:Tfap2d UTSW 1 19104760 missense possibly damaging 0.46
R6281:Tfap2d UTSW 1 19104478 missense probably benign 0.12
R6283:Tfap2d UTSW 1 19104478 missense probably benign 0.12
R6492:Tfap2d UTSW 1 19104478 missense probably benign 0.12
R6493:Tfap2d UTSW 1 19104478 missense probably benign 0.12
R6751:Tfap2d UTSW 1 19103283 missense possibly damaging 0.72
R7288:Tfap2d UTSW 1 19118983 missense probably damaging 1.00
R7400:Tfap2d UTSW 1 19142926 missense possibly damaging 0.70
R8156:Tfap2d UTSW 1 19103262 missense probably benign
R8551:Tfap2d UTSW 1 19104800 missense probably benign 0.08
R8838:Tfap2d UTSW 1 19104812 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TAAGCGTGCTCCAGCTCTATG -3'
(R):5'- GTATTGGAGAGTCCCCAGCAAAG -3'

Sequencing Primer
(F):5'- CTCCAGCTCTATGGTGCTTTGAATG -3'
(R):5'- ATGTAGATACGCCTGTATGGACC -3'
Posted On 2021-03-08