Incidental Mutation 'R8686:Col5a2'
ID 662016
Institutional Source Beutler Lab
Gene Symbol Col5a2
Ensembl Gene ENSMUSG00000026042
Gene Name collagen, type V, alpha 2
Synonyms 1110014L14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8686 (G1)
Quality Score 207.009
Status Validated
Chromosome 1
Chromosomal Location 45374321-45503282 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 45421987 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 250 (G250D)
Ref Sequence ENSEMBL: ENSMUSP00000083620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086430]
AlphaFold Q3U962
Predicted Effect probably damaging
Transcript: ENSMUST00000086430
AA Change: G250D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083620
Gene: ENSMUSG00000026042
AA Change: G250D

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VWC 40 95 9.94e-23 SMART
Pfam:Collagen 123 186 1.5e-10 PFAM
Pfam:Collagen 207 272 2.9e-9 PFAM
low complexity region 319 347 N/A INTRINSIC
internal_repeat_1 349 421 3.18e-18 PROSPERO
internal_repeat_2 385 422 1.34e-12 PROSPERO
internal_repeat_5 388 423 1.55e-7 PROSPERO
low complexity region 424 460 N/A INTRINSIC
low complexity region 471 508 N/A INTRINSIC
internal_repeat_6 509 535 5.68e-7 PROSPERO
internal_repeat_2 511 548 1.34e-12 PROSPERO
internal_repeat_3 520 549 1.16e-11 PROSPERO
internal_repeat_1 520 571 3.18e-18 PROSPERO
internal_repeat_4 546 574 4.91e-9 PROSPERO
low complexity region 595 611 N/A INTRINSIC
internal_repeat_7 616 741 1.35e-6 PROSPERO
low complexity region 742 757 N/A INTRINSIC
Pfam:Collagen 790 870 4.8e-8 PFAM
low complexity region 877 898 N/A INTRINSIC
Pfam:Collagen 907 979 4.2e-8 PFAM
internal_repeat_4 993 1021 4.91e-9 PROSPERO
internal_repeat_3 994 1023 1.16e-11 PROSPERO
low complexity region 1024 1054 N/A INTRINSIC
internal_repeat_6 1055 1078 5.68e-7 PROSPERO
low complexity region 1081 1096 N/A INTRINSIC
Pfam:Collagen 1111 1171 9.7e-12 PFAM
Pfam:Collagen 1168 1230 1.4e-9 PFAM
COLFI 1263 1497 1.83e-164 SMART
Meta Mutation Damage Score 0.9633 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: This gene encodes the alpha-2 subunit of type V collagen, one of the low abundance fibrillar collagens that gets incorporated into growing fibrils with type I collagen. The encoded protein, in association with alpha-1 and/or alpha-3 subunits, forms homo- or heterotrimeric type V procollagen that undergoes proteolytic processing. Mice lacking the encoded protein die in utero. Transgenic mice that produce a structurally abnormal form of the encoded protein survive poorly and exhibit skin fragility, skeletal abnormalities and alterations in the collagen fiber organization. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutation of this gene results in perinatal lethality. Mutant animals exhibit reduced body weight, reduced bone growth rate, thin, fragile skin, variable degrees of lordosis and kyphosis, abnormal localization of hair follicles in the dermis, and thinned stroma of the cornea. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik C T 9: 103,259,428 A525T probably benign Het
Adam25 A G 8: 40,755,484 T596A probably benign Het
Adamts6 A G 13: 104,313,699 I303V probably damaging Het
Alpl A T 4: 137,743,801 H341Q probably damaging Het
Cachd1 G A 4: 100,988,128 R939H probably damaging Het
Ccdc114 A G 7: 45,947,692 T456A probably benign Het
Cd22 G A 7: 30,870,069 R541C probably benign Het
Cenpf A T 1: 189,659,604 M660K probably benign Het
Cmya5 A T 13: 93,095,380 S1067T possibly damaging Het
Cylc2 C T 4: 51,229,651 T331M unknown Het
Dgka A G 10: 128,733,093 M201T probably benign Het
Dnajc13 T C 9: 104,170,805 I1804V probably benign Het
Dym T A 18: 75,286,683 Y642N probably damaging Het
Efr3b A T 12: 4,000,886 D26E probably damaging Het
Emilin1 A T 5: 30,917,696 K427M possibly damaging Het
Fam187b T C 7: 30,977,234 L56S probably benign Het
Fbxo18 C T 2: 11,755,658 V694I probably benign Het
Fgd2 C T 17: 29,379,023 T644I probably benign Het
G6pc T G 11: 101,374,707 probably null Het
Gli2 A G 1: 118,836,687 S1245P probably benign Het
Gm10696 T C 3: 94,176,120 D128G probably benign Het
Gpr137b T C 13: 13,359,406 Y355C Het
Ighv1-84 T C 12: 115,980,904 D50G probably benign Het
Impdh1 C A 6: 29,216,215 probably benign Het
Irf4 A T 13: 30,761,450 D393V possibly damaging Het
Kalrn A G 16: 34,360,935 L111P probably damaging Het
Lrch3 T C 16: 32,981,853 V58A possibly damaging Het
Lrif1 C T 3: 106,732,781 T394I probably damaging Het
Map4k1 A G 7: 28,994,073 T434A probably benign Het
Mcur1 G A 13: 43,541,717 T327M probably damaging Het
Mettl7b A T 10: 128,960,607 M111K possibly damaging Het
Myo9b G T 8: 71,334,322 S716I probably benign Het
Nol10 T A 12: 17,369,771 probably benign Het
Nos3 A G 5: 24,368,843 T202A possibly damaging Het
Olfr128 T C 17: 37,924,277 V237A probably benign Het
Olfr710 A C 7: 106,944,698 M101R probably benign Het
Parp12 A T 6: 39,117,922 S80T probably benign Het
Pde1a C T 2: 79,927,742 V50I probably benign Het
Pfkl A T 10: 77,997,522 probably null Het
Phkg1 A T 5: 129,866,215 Y207N probably damaging Het
Pik3r4 A G 9: 105,658,529 T640A possibly damaging Het
Pip5k1c C A 10: 81,311,993 H411N probably damaging Het
Pla2g4e A G 2: 120,244,691 S73P probably damaging Het
Polr2b T C 5: 77,335,663 V662A probably damaging Het
Prss43 C T 9: 110,829,426 R265C possibly damaging Het
Rap1b A T 10: 117,822,841 V29D probably damaging Het
Rraga A G 4: 86,576,811 E298G probably damaging Het
Rrp8 A T 7: 105,733,574 I418N probably damaging Het
Siglecf T C 7: 43,355,606 V420A probably benign Het
Snx14 T A 9: 88,415,693 N174I probably damaging Het
Speer4e T C 5: 14,934,115 N229S probably benign Het
Teddm3 A G 16: 21,152,935 *295Q probably null Het
Tfap2c A G 2: 172,552,006 D245G possibly damaging Het
Tfap2d A G 1: 19,108,284 N191S probably benign Het
Unc80 A G 1: 66,612,268 R1591G possibly damaging Het
Vmn1r116 T C 7: 20,872,691 W146R probably damaging Het
Vps13b C G 15: 35,925,389 S3823R probably damaging Het
Wiz T A 17: 32,367,847 D163V probably damaging Het
Xylt1 G C 7: 117,381,359 A61P unknown Het
Zfp521 A C 18: 13,845,644 F571V probably damaging Het
Zfp664 T A 5: 124,886,069 C176S possibly damaging Het
Zfyve26 T C 12: 79,287,453 N264D probably benign Het
Other mutations in Col5a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Col5a2 APN 1 45392877 splice site probably benign
IGL00978:Col5a2 APN 1 45376739 missense probably benign 0.01
IGL01366:Col5a2 APN 1 45391888 missense possibly damaging 0.46
IGL01487:Col5a2 APN 1 45376739 missense probably benign 0.01
IGL01820:Col5a2 APN 1 45442825 missense unknown
IGL01980:Col5a2 APN 1 45382233 splice site probably benign
IGL02063:Col5a2 APN 1 45403419 critical splice donor site probably null
IGL02134:Col5a2 APN 1 45391070 splice site probably null
IGL02233:Col5a2 APN 1 45383587 splice site probably null
IGL02489:Col5a2 APN 1 45392811 splice site probably null
IGL02928:Col5a2 APN 1 45385020 missense probably benign 0.41
IGL02931:Col5a2 APN 1 45385065 missense probably damaging 1.00
IGL03328:Col5a2 APN 1 45376146 missense possibly damaging 0.94
Beatnik UTSW 1 45376778 missense probably damaging 0.99
R0022:Col5a2 UTSW 1 45383683 nonsense probably null
R0123:Col5a2 UTSW 1 45407035 missense probably benign 0.28
R0180:Col5a2 UTSW 1 45411460 missense probably damaging 1.00
R0225:Col5a2 UTSW 1 45407035 missense probably benign 0.28
R0455:Col5a2 UTSW 1 45382102 splice site probably benign
R0485:Col5a2 UTSW 1 45378482 missense probably damaging 0.99
R0702:Col5a2 UTSW 1 45380131 missense possibly damaging 0.54
R0745:Col5a2 UTSW 1 45407227 splice site probably null
R1147:Col5a2 UTSW 1 45376771 missense probably damaging 0.99
R1147:Col5a2 UTSW 1 45376771 missense probably damaging 0.99
R1394:Col5a2 UTSW 1 45403419 critical splice donor site probably null
R1494:Col5a2 UTSW 1 45502914 start codon destroyed unknown
R1499:Col5a2 UTSW 1 45411466 missense probably benign 0.00
R1733:Col5a2 UTSW 1 45407032 missense possibly damaging 0.81
R1789:Col5a2 UTSW 1 45378305 critical splice donor site probably null
R1789:Col5a2 UTSW 1 45394776 missense probably damaging 0.98
R2114:Col5a2 UTSW 1 45376804 missense probably damaging 0.98
R2915:Col5a2 UTSW 1 45413496 missense probably damaging 1.00
R3861:Col5a2 UTSW 1 45380237 missense probably damaging 0.98
R4015:Col5a2 UTSW 1 45403471 missense probably benign 0.14
R4944:Col5a2 UTSW 1 45376695 missense possibly damaging 0.75
R4982:Col5a2 UTSW 1 45389458 missense possibly damaging 0.88
R5001:Col5a2 UTSW 1 45502898 missense unknown
R5159:Col5a2 UTSW 1 45386831 critical splice donor site probably null
R5197:Col5a2 UTSW 1 45393081 missense probably benign 0.01
R5407:Col5a2 UTSW 1 45406280 missense possibly damaging 0.54
R5502:Col5a2 UTSW 1 45380126 missense probably damaging 1.00
R5575:Col5a2 UTSW 1 45378482 missense probably damaging 0.99
R5622:Col5a2 UTSW 1 45427059 missense probably benign
R5643:Col5a2 UTSW 1 45390042 missense probably damaging 1.00
R5801:Col5a2 UTSW 1 45389481 critical splice acceptor site probably null
R6075:Col5a2 UTSW 1 45502848 missense unknown
R6211:Col5a2 UTSW 1 45376666 missense probably damaging 0.99
R6407:Col5a2 UTSW 1 45376778 missense probably damaging 0.99
R6494:Col5a2 UTSW 1 45378327 missense probably damaging 0.99
R6582:Col5a2 UTSW 1 45390115 missense possibly damaging 0.91
R6687:Col5a2 UTSW 1 45383604 missense probably damaging 1.00
R7007:Col5a2 UTSW 1 45378449 missense possibly damaging 0.53
R7062:Col5a2 UTSW 1 45417625 missense probably benign 0.00
R7098:Col5a2 UTSW 1 45380067 missense possibly damaging 0.48
R7243:Col5a2 UTSW 1 45376160 missense probably benign 0.39
R7326:Col5a2 UTSW 1 45442867 missense unknown
R7332:Col5a2 UTSW 1 45380165 missense probably damaging 1.00
R7642:Col5a2 UTSW 1 45376088 missense probably benign 0.01
R7890:Col5a2 UTSW 1 45404987 splice site probably null
R8066:Col5a2 UTSW 1 45413468 critical splice donor site probably null
R8375:Col5a2 UTSW 1 45442730 missense unknown
R8444:Col5a2 UTSW 1 45396145 missense probably benign 0.06
R8506:Col5a2 UTSW 1 45442784 missense unknown
R8907:Col5a2 UTSW 1 45416946 missense probably benign 0.27
R8932:Col5a2 UTSW 1 45380146 missense probably benign 0.00
R8933:Col5a2 UTSW 1 45421963 missense
R9087:Col5a2 UTSW 1 45442658 missense unknown
R9105:Col5a2 UTSW 1 45380206 missense probably benign 0.00
R9282:Col5a2 UTSW 1 45438869 critical splice donor site probably null
R9457:Col5a2 UTSW 1 45386844 missense probably benign 0.00
R9457:Col5a2 UTSW 1 45392813 critical splice donor site probably null
R9568:Col5a2 UTSW 1 45391838 missense possibly damaging 0.89
X0013:Col5a2 UTSW 1 45403258 critical splice donor site probably null
Z1176:Col5a2 UTSW 1 45376146 missense possibly damaging 0.94
Z1176:Col5a2 UTSW 1 45383680 missense probably damaging 1.00
Z1176:Col5a2 UTSW 1 45396484 missense probably benign 0.11
Z1177:Col5a2 UTSW 1 45402113 missense probably damaging 1.00
Z1177:Col5a2 UTSW 1 45403473 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAAACCTTAACCTGTGTTCTAC -3'
(R):5'- GATACTAGATTTGAGCAGTTCAGTG -3'

Sequencing Primer
(F):5'- ACCTGTGTTCTACATTTTAAAGTGG -3'
(R):5'- GTTCTTGTGCACCAGATCTGAGAC -3'
Posted On 2021-03-08