Incidental Mutation 'R8686:Gli2'
ID 662018
Institutional Source Beutler Lab
Gene Symbol Gli2
Ensembl Gene ENSMUSG00000048402
Gene Name GLI-Kruppel family member GLI2
Synonyms
MMRRC Submission 068541-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8686 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 118761862-118981349 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 118764417 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1245 (S1245P)
Ref Sequence ENSEMBL: ENSMUSP00000054837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062483]
AlphaFold Q0VGT2
Predicted Effect probably benign
Transcript: ENSMUST00000062483
AA Change: S1245P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000054837
Gene: ENSMUSG00000048402
AA Change: S1245P

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 36 43 N/A INTRINSIC
low complexity region 259 278 N/A INTRINSIC
ZnF_C2H2 417 442 4.98e-1 SMART
ZnF_C2H2 450 477 6.57e0 SMART
ZnF_C2H2 483 507 2.09e-3 SMART
ZnF_C2H2 513 538 4.17e-3 SMART
ZnF_C2H2 544 569 1.84e-4 SMART
low complexity region 637 657 N/A INTRINSIC
low complexity region 876 890 N/A INTRINSIC
low complexity region 930 945 N/A INTRINSIC
low complexity region 1035 1053 N/A INTRINSIC
low complexity region 1428 1435 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the C2H2-type zinc finger protein subclass of the Gli family. Members of this subclass are characterized as transcription factors which bind DNA through zinc finger motifs. These motifs contain conserved H-C links. Gli family zinc finger proteins are mediators of Sonic hedgehog (Shh) signaling and they are implicated as potent oncogenes in the embryonal carcinoma cell. The protein encoded by this gene localizes to the cytoplasm and activates patched Drosophila homolog (PTCH) gene expression. It is also thought to play a role during embryogenesis. The encoded protein is associated with several phenotypes- Greig cephalopolysyndactyly syndrome, Pallister-Hall syndrome, preaxial polydactyly type IV, postaxial polydactyly types A1 and B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit skeletal malformations, absence of floorplate and foregut, lung and anorectal defects, and altered commissural neuron guidance. Most mutants die before embryonic day 18.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 A G 8: 41,208,521 (GRCm39) T596A probably benign Het
Adamts6 A G 13: 104,450,207 (GRCm39) I303V probably damaging Het
Alpl A T 4: 137,471,112 (GRCm39) H341Q probably damaging Het
Cachd1 G A 4: 100,845,325 (GRCm39) R939H probably damaging Het
Cd22 G A 7: 30,569,494 (GRCm39) R541C probably benign Het
Cenpf A T 1: 189,391,801 (GRCm39) M660K probably benign Het
Cmya5 A T 13: 93,231,888 (GRCm39) S1067T possibly damaging Het
Col5a2 C T 1: 45,461,147 (GRCm39) G250D probably damaging Het
Cylc2 C T 4: 51,229,651 (GRCm39) T331M unknown Het
Dgka A G 10: 128,568,962 (GRCm39) M201T probably benign Het
Dnajc13 T C 9: 104,048,004 (GRCm39) I1804V probably benign Het
Dym T A 18: 75,419,754 (GRCm39) Y642N probably damaging Het
Efr3b A T 12: 4,050,886 (GRCm39) D26E probably damaging Het
Emilin1 A T 5: 31,075,040 (GRCm39) K427M possibly damaging Het
Fam187b T C 7: 30,676,659 (GRCm39) L56S probably benign Het
Fbh1 C T 2: 11,760,469 (GRCm39) V694I probably benign Het
Fgd2 C T 17: 29,597,997 (GRCm39) T644I probably benign Het
G6pc1 T G 11: 101,265,533 (GRCm39) probably null Het
Gpr137b T C 13: 13,533,991 (GRCm39) Y355C Het
Ighv1-84 T C 12: 115,944,524 (GRCm39) D50G probably benign Het
Impdh1 C A 6: 29,216,214 (GRCm39) probably benign Het
Inhca C T 9: 103,136,627 (GRCm39) A525T probably benign Het
Irf4 A T 13: 30,945,433 (GRCm39) D393V possibly damaging Het
Kalrn A G 16: 34,181,305 (GRCm39) L111P probably damaging Het
Lrch3 T C 16: 32,802,223 (GRCm39) V58A possibly damaging Het
Lrif1 C T 3: 106,640,097 (GRCm39) T394I probably damaging Het
Map4k1 A G 7: 28,693,498 (GRCm39) T434A probably benign Het
Mcur1 G A 13: 43,695,193 (GRCm39) T327M probably damaging Het
Myo9b G T 8: 71,786,966 (GRCm39) S716I probably benign Het
Nol10 T A 12: 17,419,772 (GRCm39) probably benign Het
Nos3 A G 5: 24,573,841 (GRCm39) T202A possibly damaging Het
Odad1 A G 7: 45,597,116 (GRCm39) T456A probably benign Het
Or14j7 T C 17: 38,235,168 (GRCm39) V237A probably benign Het
Or2d4 A C 7: 106,543,905 (GRCm39) M101R probably benign Het
Parp12 A T 6: 39,094,856 (GRCm39) S80T probably benign Het
Pde1a C T 2: 79,758,086 (GRCm39) V50I probably benign Het
Pfkl A T 10: 77,833,356 (GRCm39) probably null Het
Phkg1 A T 5: 129,895,056 (GRCm39) Y207N probably damaging Het
Pik3r4 A G 9: 105,535,728 (GRCm39) T640A possibly damaging Het
Pip5k1c C A 10: 81,147,827 (GRCm39) H411N probably damaging Het
Pla2g4e A G 2: 120,075,172 (GRCm39) S73P probably damaging Het
Polr2b T C 5: 77,483,510 (GRCm39) V662A probably damaging Het
Prss43 C T 9: 110,658,494 (GRCm39) R265C possibly damaging Het
Rap1b A T 10: 117,658,746 (GRCm39) V29D probably damaging Het
Rraga A G 4: 86,495,048 (GRCm39) E298G probably damaging Het
Rrp8 A T 7: 105,382,781 (GRCm39) I418N probably damaging Het
Siglecf T C 7: 43,005,030 (GRCm39) V420A probably benign Het
Snx14 T A 9: 88,297,746 (GRCm39) N174I probably damaging Het
Speer4e1 T C 5: 14,984,129 (GRCm39) N229S probably benign Het
Spopfm2 T C 3: 94,083,427 (GRCm39) D128G probably benign Het
Teddm3 A G 16: 20,971,685 (GRCm39) *295Q probably null Het
Tfap2c A G 2: 172,393,926 (GRCm39) D245G possibly damaging Het
Tfap2d A G 1: 19,178,508 (GRCm39) N191S probably benign Het
Tmt1b A T 10: 128,796,476 (GRCm39) M111K possibly damaging Het
Unc80 A G 1: 66,651,427 (GRCm39) R1591G possibly damaging Het
Vmn1r116 T C 7: 20,606,616 (GRCm39) W146R probably damaging Het
Vps13b C G 15: 35,925,535 (GRCm39) S3823R probably damaging Het
Wiz T A 17: 32,586,821 (GRCm39) D163V probably damaging Het
Xylt1 G C 7: 116,980,594 (GRCm39) A61P unknown Het
Zfp521 A C 18: 13,978,701 (GRCm39) F571V probably damaging Het
Zfp664 T A 5: 124,963,133 (GRCm39) C176S possibly damaging Het
Zfyve26 T C 12: 79,334,227 (GRCm39) N264D probably benign Het
Other mutations in Gli2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Gli2 APN 1 118,764,621 (GRCm39) missense probably benign
IGL01686:Gli2 APN 1 118,776,165 (GRCm39) missense probably damaging 1.00
IGL01925:Gli2 APN 1 118,781,106 (GRCm39) missense probably damaging 1.00
IGL02106:Gli2 APN 1 118,764,465 (GRCm39) missense probably benign
IGL02202:Gli2 APN 1 118,764,596 (GRCm39) missense probably damaging 0.96
IGL02255:Gli2 APN 1 118,772,079 (GRCm39) critical splice donor site probably null
IGL02437:Gli2 APN 1 118,763,733 (GRCm39) missense probably damaging 1.00
IGL02615:Gli2 APN 1 118,772,128 (GRCm39) missense probably damaging 1.00
IGL02817:Gli2 APN 1 118,764,101 (GRCm39) missense possibly damaging 0.55
IGL03294:Gli2 APN 1 118,765,166 (GRCm39) missense probably benign
fairyfly UTSW 1 118,768,220 (GRCm39) missense possibly damaging 0.93
flea UTSW 1 118,763,655 (GRCm39) missense probably damaging 0.99
patu_digua UTSW 1 118,765,236 (GRCm39) missense probably damaging 1.00
BB006:Gli2 UTSW 1 118,769,772 (GRCm39) missense possibly damaging 0.88
BB016:Gli2 UTSW 1 118,769,772 (GRCm39) missense possibly damaging 0.88
R0055:Gli2 UTSW 1 118,818,138 (GRCm39) intron probably benign
R0055:Gli2 UTSW 1 118,818,138 (GRCm39) intron probably benign
R0164:Gli2 UTSW 1 118,818,013 (GRCm39) intron probably benign
R0233:Gli2 UTSW 1 118,763,655 (GRCm39) missense probably damaging 0.99
R0233:Gli2 UTSW 1 118,763,655 (GRCm39) missense probably damaging 0.99
R0308:Gli2 UTSW 1 118,769,792 (GRCm39) missense probably benign 0.00
R0418:Gli2 UTSW 1 118,768,220 (GRCm39) missense possibly damaging 0.93
R0558:Gli2 UTSW 1 118,765,379 (GRCm39) missense probably benign 0.01
R0600:Gli2 UTSW 1 118,768,119 (GRCm39) missense probably damaging 1.00
R0630:Gli2 UTSW 1 118,769,648 (GRCm39) missense possibly damaging 0.52
R0690:Gli2 UTSW 1 118,772,190 (GRCm39) missense probably damaging 1.00
R0942:Gli2 UTSW 1 118,765,236 (GRCm39) missense probably damaging 1.00
R1061:Gli2 UTSW 1 118,782,247 (GRCm39) missense possibly damaging 0.71
R1104:Gli2 UTSW 1 118,781,080 (GRCm39) missense probably damaging 1.00
R1141:Gli2 UTSW 1 118,765,667 (GRCm39) missense possibly damaging 0.71
R1344:Gli2 UTSW 1 118,769,666 (GRCm39) missense probably damaging 0.98
R1418:Gli2 UTSW 1 118,769,666 (GRCm39) missense probably damaging 0.98
R1565:Gli2 UTSW 1 118,769,660 (GRCm39) missense possibly damaging 0.57
R1605:Gli2 UTSW 1 118,782,290 (GRCm39) missense probably damaging 1.00
R1640:Gli2 UTSW 1 118,764,254 (GRCm39) missense possibly damaging 0.83
R1728:Gli2 UTSW 1 118,929,774 (GRCm39) missense probably benign 0.00
R1728:Gli2 UTSW 1 118,795,817 (GRCm39) missense possibly damaging 0.68
R1729:Gli2 UTSW 1 118,929,774 (GRCm39) missense probably benign 0.00
R1729:Gli2 UTSW 1 118,795,817 (GRCm39) missense possibly damaging 0.68
R1730:Gli2 UTSW 1 118,929,774 (GRCm39) missense probably benign 0.00
R1730:Gli2 UTSW 1 118,795,817 (GRCm39) missense possibly damaging 0.68
R1739:Gli2 UTSW 1 118,929,774 (GRCm39) missense probably benign 0.00
R1739:Gli2 UTSW 1 118,795,817 (GRCm39) missense possibly damaging 0.68
R1762:Gli2 UTSW 1 118,929,774 (GRCm39) missense probably benign 0.00
R1762:Gli2 UTSW 1 118,795,817 (GRCm39) missense possibly damaging 0.68
R1783:Gli2 UTSW 1 118,929,774 (GRCm39) missense probably benign 0.00
R1783:Gli2 UTSW 1 118,795,817 (GRCm39) missense possibly damaging 0.68
R1785:Gli2 UTSW 1 118,929,774 (GRCm39) missense probably benign 0.00
R1785:Gli2 UTSW 1 118,795,817 (GRCm39) missense possibly damaging 0.68
R1874:Gli2 UTSW 1 118,929,779 (GRCm39) missense possibly damaging 0.83
R1969:Gli2 UTSW 1 118,765,430 (GRCm39) missense probably benign 0.00
R2199:Gli2 UTSW 1 118,765,378 (GRCm39) missense possibly damaging 0.95
R2377:Gli2 UTSW 1 118,764,855 (GRCm39) missense possibly damaging 0.90
R2883:Gli2 UTSW 1 118,795,874 (GRCm39) missense probably damaging 0.97
R2924:Gli2 UTSW 1 118,764,089 (GRCm39) missense probably benign 0.00
R4363:Gli2 UTSW 1 118,781,100 (GRCm39) missense probably benign 0.00
R4430:Gli2 UTSW 1 118,764,974 (GRCm39) missense probably benign
R4463:Gli2 UTSW 1 118,763,738 (GRCm39) missense probably damaging 1.00
R4583:Gli2 UTSW 1 118,769,798 (GRCm39) missense probably benign
R4613:Gli2 UTSW 1 118,765,241 (GRCm39) missense probably damaging 1.00
R4674:Gli2 UTSW 1 118,763,759 (GRCm39) missense probably damaging 1.00
R4735:Gli2 UTSW 1 118,768,052 (GRCm39) missense probably damaging 1.00
R4770:Gli2 UTSW 1 118,910,318 (GRCm39) intron probably benign
R4936:Gli2 UTSW 1 118,763,870 (GRCm39) missense probably benign
R5137:Gli2 UTSW 1 118,783,233 (GRCm39) missense probably damaging 1.00
R5228:Gli2 UTSW 1 118,763,936 (GRCm39) missense probably damaging 1.00
R5318:Gli2 UTSW 1 118,772,200 (GRCm39) missense probably damaging 1.00
R5619:Gli2 UTSW 1 118,764,485 (GRCm39) missense probably benign 0.27
R5661:Gli2 UTSW 1 118,781,032 (GRCm39) nonsense probably null
R6005:Gli2 UTSW 1 118,769,794 (GRCm39) missense probably damaging 1.00
R6012:Gli2 UTSW 1 118,765,445 (GRCm39) missense probably damaging 0.99
R6341:Gli2 UTSW 1 118,763,954 (GRCm39) missense probably damaging 1.00
R6357:Gli2 UTSW 1 118,769,689 (GRCm39) missense probably damaging 1.00
R6425:Gli2 UTSW 1 118,763,624 (GRCm39) nonsense probably null
R6513:Gli2 UTSW 1 118,783,284 (GRCm39) missense probably damaging 1.00
R6802:Gli2 UTSW 1 118,769,795 (GRCm39) missense probably damaging 1.00
R6889:Gli2 UTSW 1 118,772,146 (GRCm39) missense probably damaging 1.00
R7259:Gli2 UTSW 1 118,764,264 (GRCm39) missense probably benign
R7378:Gli2 UTSW 1 118,776,222 (GRCm39) missense probably damaging 1.00
R7420:Gli2 UTSW 1 118,763,669 (GRCm39) missense probably benign 0.00
R7489:Gli2 UTSW 1 118,765,905 (GRCm39) missense probably benign 0.00
R7498:Gli2 UTSW 1 118,763,565 (GRCm39) missense possibly damaging 0.89
R7929:Gli2 UTSW 1 118,769,772 (GRCm39) missense possibly damaging 0.88
R8032:Gli2 UTSW 1 118,763,900 (GRCm39) missense probably damaging 0.98
R8150:Gli2 UTSW 1 118,763,558 (GRCm39) missense probably damaging 0.99
R8233:Gli2 UTSW 1 118,772,167 (GRCm39) missense probably damaging 1.00
R8282:Gli2 UTSW 1 118,765,701 (GRCm39) missense probably damaging 1.00
R8312:Gli2 UTSW 1 118,795,842 (GRCm39) intron probably benign
R8698:Gli2 UTSW 1 118,769,887 (GRCm39) missense probably damaging 1.00
R8935:Gli2 UTSW 1 118,764,122 (GRCm39) missense probably damaging 1.00
R8938:Gli2 UTSW 1 118,763,935 (GRCm39) missense probably damaging 1.00
R8955:Gli2 UTSW 1 118,783,187 (GRCm39) missense probably damaging 1.00
R9214:Gli2 UTSW 1 118,795,791 (GRCm39) missense probably damaging 1.00
R9232:Gli2 UTSW 1 118,764,021 (GRCm39) missense probably benign 0.00
R9295:Gli2 UTSW 1 118,764,996 (GRCm39) missense probably damaging 1.00
R9369:Gli2 UTSW 1 118,765,885 (GRCm39) missense probably benign 0.04
R9496:Gli2 UTSW 1 118,764,425 (GRCm39) missense probably benign 0.00
R9757:Gli2 UTSW 1 118,773,652 (GRCm39) missense probably damaging 1.00
X0028:Gli2 UTSW 1 118,765,007 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGCTCAGGACTGGGTGAG -3'
(R):5'- CCAACAGAAGCCAGCCTTTG -3'

Sequencing Primer
(F):5'- TGAGGTTGTGACACCGCAG -3'
(R):5'- TGGCCAGTATCCAGGATATAATC -3'
Posted On 2021-03-08